BID (NM_197967) Human Untagged Clone

CAT#: SC108979

BID (untagged)-Human BH3 interacting domain death agonist (BID), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: BID
• Synonyms: FP497
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene ORF within SC108979 sequence for NM_197967 edited (data generated by NextGen Sequencing)
  ATGGACCGTAGCATCCCTCCGGGCCTGGTGAACGGCCTGGCCCTGCAGCTCAGGAACACC
  AGCCGGTCGGAGGAGGACCGGAACAGGGACCTGGCCACTGCCCTGGAGCAGCTGCTGCAG
  GCCTACCCTAGAGACATGGAGAAGGAGAAGACCATGCTGGTGCTGGCCCTGCTGCTGGCC
  AAGAAGGTGGCCAGTCACACGCCGTCCTTGCTCCGTGATGTCTTTCACACAACAGTGAAC
  TTTATTAACCAGAACCTACGCACCTACGTGAGGAGCTTAGCCAGAAATGGGATGGACTGA
  
  Clone variation with respect to NM_197967.2
  240 t=>c
  5' Read Nucleotide Sequence

  >OriGene 5' read for NM_197967 unedited
  AATTTGTATACGACTCCTATAGGCGGCCGCGAATTCGGCACGAGGAACGGTTCCAGCCTC
  AGGGATGAGTGCATCACAAACCTACTGGTGTTTGGCTTCCTCCAAAGCTGTTCTGACAAC
  AGCTTCCGCAGAGAGCTGGACGCACTGGGCCACGAGCTGCCAGTGCTGGCTCCCCAGTGG
  GAGGGCTACGATGAGCTGCAGACTGATGGCAACCGCAGCAGCCACTCCCGCTTGGGAAGA
  ATAGAGGCAGATTCTGAAAGTCAAGAAGACATCATCCGGAATATTGCCAGGCACCTCGCC
  CAGGTCGGGGACAGCATGGACCGTACCATCCCTCCGGGCCTGGTGAACGGCCTGGCCCTG
  CAGCTCAGGAACACCAGCCGGTCGGAGGAGGACCGGAACAGGGACCTGGCCACTGCCCTG
  GAGCAGCTGCTGCAGGCCTACCCTAGAGACATGGAGAAGGAGAAGACCATGCTGGTGCTG
  GCCCTGCTGCTGGCCAAGAAGGTGGCCAGTCACACGCCGTCCTTGCTCCGTGATGTCTTT
  CACACAACAGTGAACTTTATTAACCAGAACCTACGCACCTACGTGAGGAGCTTAGCCAGA
  AATGGGATGGACTGAACGGACAGTTCCAGAAGTGCGACTGGCTAAAGCTCGATGTGGTCA
  CAGCTGTATAGCTGCTTCCAGTGTAGACGGAGCCCTGGCATGTCAACAGCGTTCCTAGAG
  AAGACCAGCCTGGAAGATAGCTGTGACTTCTATTTTAAAGACCATGCTCAACTTAAACCC
  CACTTTCAAATATCCACATTAATATACTTGAATGACAATGTCCATTTACACGTATTTGAA
  TGGCCTTCATATCATCCCCACATGAATCTGCCCTCTTG
  
• Restriction Sites: NotI-NotI
• ACCN: NM_197967
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_197967.1, NP_932071.1
• RefSeq Size: 2144 bp
• RefSeq ORF: 300 bp
• Locus ID: 637
• Cytogenetics: 22q11.21
• Protein Families: Druggable Genome
• Protein Pathways: Alzheimer's disease, Amyotrophic lateral sclerosis (ALS), Apoptosis, Natural killer cell mediated cytotoxicity, p53 signaling pathway, Pathways in cancer, Viral myocarditis
• Gene Summary: 'This gene encodes a death agonist that heterodimerizes with either agonist BAX or antagonist BCL2, and thus regulate apoptosis. The encoded protein is a member of the BCL-2 family of cell death regulators. It is a mediator of mitochondrial damage induced by caspase-8 (CASP8); CASP8 cleaves this encoded protein, and the COOH-terminal part translocates to mitochondria where it triggers cytochrome c release. Multiple alternatively spliced transcript variants have been found. [provided by RefSeq, Aug 2020]'
  Transcript Variant: This variant (3) differs in the 5' region and uses a downstream start codon, as compared to variant 1. It encodes isoform 3 which has a shorter N-terminus, as compared to isoform 1.