Placental lactogen (CSH1) (NM_022641) Human Untagged Clone
CAT#: SC109120
CSH1 (untagged)-Human chorionic somatomammotropin hormone 1 (placental lactogen) (CSH1), transcript variant 3
Product Images
Other products for "CSH1"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CSH1 |
Synonyms | CSA; CSH2; CSMT; FLJ75407; PL |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_022641, the custom clone sequence may differ by one or more nucleotides
ATGGCTCCAGGCTCCCGGACGTCCCTGCTCCTGGCTTTTGCCCTGCTCTGCCTGCCCTGGCTTCAAGAGG CTGGTGCCGTCCAAACCGTTCCGTTATCCAGGCTTTTTGACCACGCTATGCTCCAAGCCCATCGCGCGCA CCAGCTGGCCATTGACACCTACCAGGAGTTTAGGCTGGAAGACGGCAGCCGCCGGACTGGGCAGATCCTC AAGCAGACCTACAGCAAGTTTGACACAAACTCGCACAACCATGACGCACTGCTCAAGAACTACGGGCTGC TCTACTGCTTCAGGAAGGACATGGACAAGGTCGAGACATTCCTGCGCATGGTGCAGTGCCGCTCTGTGGA GGGCAGCTGTGGCTTCTAG >OriGene 5' read for NM_022641 unedited
CACGATCCCAACTCCCCGAACCACTCATGGTCCTGTGGACAGCTCACCTAGTGGCAATGG CTCCAGGCTCCCGGACGTCCCTGCTCCTGGCTTTTGCCCTGCTCTGCCTGCCCTGGCTTC AAGAGGCTGGTGCCGTCCAAACCGTTCCGTTATCCATGCTTTTTGACCACGCTATGCTCC AAGCCCATCGCGCGCACCAGCTGGCCATTGACACCTACCAGGAGTTTGAAGAAACCTATA TCCCAAAGGACCAGAAGTATTCATTCCTGCATGACTCCCATACCTCCTTCTGCTTCTCAG ACTCTATTCCGACACCCTCCAACATGGAGGAAACGCAACAGAAATCCAATCTAGAGCTGC TCCGCATCTCCCTGCTGCTCATCGAGTCGTGGCTGGAGCCCGTGCGGTTCCTCATGAGTA TGTTCGCCAACAACCTGGTGTATGACACCTCGGACAGCGATGACTATCACCTCCTAAAGG ACCTATAGGAAGGCATCCAAACGCTGATGGGGAGGCTGGAAGACGGCAGCCGCCGGACTG GGCAGATCCTCAAGCAGACCTACAGCAAGTTTGACACAAACTCGCACAACCATGACGCAC TGCTCAAGAACTACGGGCTGCTCTACTGCTTCAGGAAGGACATGGACAATGTCGAGACAT TCCTGCGCATGGTGCAGTGCCGCTCTGTGGATGGCAGCTGTGGCTTCTATGTGCCCGAGT AGCATCCTGTGACC |
Restriction Sites | NotI-NotI |
ACCN | NM_022641 |
Insert Size | 5000 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_022641.2, NP_072167.1 |
RefSeq Size | 594 bp |
RefSeq ORF | 369 bp |
Locus ID | 1442 |
Cytogenetics | 17q23.3 |
Protein Families | Druggable Genome |
Protein Pathways | Jak-STAT signaling pathway, Neuroactive ligand-receptor interaction |
Gene Summary | 'The protein encoded by this gene is a member of the somatotropin/prolactin family of hormones and plays an important role in growth control. The gene is located at the growth hormone locus on chromosome 17 along with four other related genes in the same transcriptional orientation; an arrangement which is thought to have evolved by a series of gene duplications. Although the five genes share a remarkably high degree of sequence identity, they are expressed selectively in different tissues. Alternative splicing generates additional isoforms of each of the five growth hormones, leading to further diversity and potential for specialization. This particular family member is expressed mainly in the placenta and utilizes multiple transcription initiation sites. Expression of the identical mature proteins for chorionic somatomammotropin hormones 1 and 2 is upregulated during development, although the ratio of 1 to 2 increases by term. Mutations in this gene result in placental lactogen deficiency and Silver-Russell syndrome. [provided by RefSeq, Jul 2008]' Transcript Variant: This variant (3) lacks exons 3 and 4, and encodes an isoform (3) that has an internal deletion relative to isoform 1, but retains the signal sequence, unlike the other exon skipping isoform (4). |
Documents
Product Manuals |
FAQs |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.