Cyclin B3 (CCNB3) (NM_033670) Human Untagged Clone

CAT#: SC110710

CCNB3 (untagged)-Human cyclin B3 (CCNB3), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CCNB3
• Synonyms: cyclin B3; OTTHUMP00000023292; OTTHUMP00000023293
• Vector: PCMV6-Neo
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_033670, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCTACTGCCACTACCACCCCAGAGCTCCAAACCTGTGCCTAAGAAATCTCAGTCCAGCAAAATTGTGC
  CCAGTCATCATGACCCATCTGAAAAGACGGGGGAGAATTGCCAAACGAAGATATCTCCATCTTCACTTCA
  GGAGTCTCCATCTTCACTTCAGGGAGCACTCAAAAAGAGATCAGCTTTTGAAGATCTCACTAATGTGTCC
  TTTGAGATGACCCATGAGACCCTGTACTTGGCAGTGAAGCTGGTGGATCTCTACCTAATGAAGGCAGTAT
  GCAAGAAGGATAAGTTACAACTCCTTGGTGCCACTGCCTTTATGATTGCAGCAAAATTTGAGGAGCACAA
  CTCACCTCGTGTGGATGACTTTGTGTACATCTGTGATGATAATTATCAGCGATCTGAGGTACTCAGCATG
  GAAATCAACATCCTGAACGTCCTCAAATGTGACATTAACATTCCCATCGCCTACCATTTTCTGCGCAGAT
  ATGCTAGGTGTATCCACACCAACATGAAGACACTGACCTTGTCCCGCTACATCTGCGAGATGACCCTGCA
  GGAATACCACTATGTCCAGGAGAAGGCTTCCAAGCTAGCTGCTGCCTCCTTACTCCTGGCCCTCTACATG
  AAGAAGCTCGGATACTGGGTTCCCTTCCTGGAGCATTACAGTGGCTACAGTATCTCTGAGCTTCACCCCT
  TGGTCAGACAGCTGAACAAACTGCTGACTTTCAGTTCTTACGATAGTCTCAAGGCTGTGTATTACAAGTA
  TTCTCACCCGGTCTTCTTTGAAGTCGCCAAAATCCCTGCCTTGGATATGTTGAAGCTGGAGGAGATTTTG
  AACTGTGATTGTGAGGCTCAGGGCCTGGTACTCTAG
  
  
• Restriction Sites: NotI-NotI
• ACCN: NM_033670
• ORF Size: 1212 bp
• Insert Size: 2650
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info

Reference Data

• RefSeq: NM_033670.1, NP_391990.1
• RefSeq Size: 1212
• RefSeq ORF: 1212
• Locus ID: 85417
• Domains: cyclin_C, CYCLIN, cyclin
• Protein Families: Druggable Genome
• Protein Pathways: Cell cycle, p53 signaling pathway, Progesterone-mediated oocyte maturation
• Gene Summary: The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as positive regulators of cyclin-dependent kinases (CDKs), and thereby play an essential role in the control of the cell cycle. Different cyclins exhibit distinct expression and degradation patterns, which contribute to the temporal coordination of each mitotic event. Studies of similar genes in chicken and drosophila suggest that this cyclin may associate with CDC2 and CDK2 kinases, and may be required for proper spindle reorganization and restoration of the interphase nucleus. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Oct 2011]
  Transcript Variant: This variant (1) lacks four consecutive in-frame coding exons compared to variant 3. This results in a shorter isoform (1) missing a 1104 aa internal protein segment compared to isoform 3.