Apc11 (ANAPC11) (NM_016476) Human Untagged Clone

CAT#: SC114241

ANAPC11 (untagged)-Human anaphase promoting complex subunit 11 (ANAPC11), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ANAPC11
• Synonyms: APC11; Apc11p; HSPC214
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene ORF sequence for NM_016476 edited
  ATGAAGGTGAAGATTAAGTGCTGGAACGGCGTGGCCACTTGGCTCTGGGTGGCCAACGAT
  GAGAACTGTGGCATCTGCAGGATGGCATTTAACGGATGCTGCCCTGACTGCAAGGTGCCC
  GGCGACGACTGCCCGCTGGTGTGGGGCCAGTGCTCCCACTGCTTCCACATGCATTGCATC
  CTCAAGTGGCTGCACGCACAGCAGGTGCAGCAGCACTGCCCCATGTGCCGCCAGGAATGG
  AAGTTCAAGGAGTGA
  
  5' Read Nucleotide Sequence

  >OriGene 5' read for NM_016476 unedited
  CACGAGGTCGGCGGGCGCTGTTGAGGGAGTCGGGCCGCGACTGTGGTCGTTTTTATACCT
  TCCCGCGCGGACGCCGGCGCTGCCAACGGAAGGGCGGGTAGGGCGAGACGGAGTTTCGTC
  ATGTTGGCCAGGCCCATTTGAGATCTTTGAAGATATCCTCAACGTGAGGCTCTGCTGCCA
  TGAAGGTGAAGATTAAGTGCTGGAACGGCGTGGCCACTTGGCTCTGGGTGGCCAACGATG
  AGAACTGTGGCATCTGCAGGATGGCATTTAACGGATGCTGCCCTGACTGCAAGGTGCCCG
  GCGACGACTGCCCGCTGGTGTGGGGCCAGTGCTCCCACTGCTTCCACATGCATTGCATCC
  TCAAGTGGCTGCACGCACAGCAGGTGCAGCAGCACTGCCCCATGTGCCGCCAGGAATGGA
  AGTTCAAGGAGTGAGGCCCGACCTGGCTCTCGCTGGAGGGGCATCCTGAGACTCCTTCCT
  CATGCTGGCGCCGATGGCTGCTGGGGACAGCGCCCCTGAGCTGCAACAAGGTGGAAACAA
  GGGCTGGAGCTGCGTTTGTTTTGCCATCACTATGTTGACACTTTTATCCAATAAGTGAAA
  ACTCATTAAACTACTCAAATCTTGCTGGAGGCCTCTGGGTGCCTGTGTTCTCGGCATATA
  GATGTGGTCTCGGTGTGTTTTGATATGAAAACTCTCATGAATAAACATCTCCGTGAAACG
  CC
  
• Restriction Sites: NotI-NotI
• ACCN: NM_016476
• ORF Size: 255 bp
• Insert Size: 950
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info

Reference Data

• RefSeq: NM_016476.10, NP_057560.8
• RefSeq Size: 892
• RefSeq ORF: 255
• Locus ID: 51529
• Protein Families: Druggable Genome
• Protein Pathways: Cell cycle, Oocyte meiosis, Progesterone-mediated oocyte maturation, Ubiquitin mediated proteolysis
• Gene Summary: Together with the cullin protein ANAPC2, constitutes the catalytic component of the anaphase promoting complex/cyclosome (APC/C), a cell cycle-regulated E3 ubiquitin ligase that controls progression through mitosis and the G1 phase of the cell cycle. The APC/C complex acts by mediating ubiquitination and subsequent degradation of target proteins: it mainly mediates the formation of 'Lys-11'-linked polyubiquitin chains and, to a lower extent, the formation of 'Lys-48'- and 'Lys-63'-linked polyubiquitin chains. May recruit the E2 ubiquitin-conjugating enzymes to the complex. [UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (2) contains an alternate exon in the 5' UTR and lacks an exon in the 3' coding region, which results in a frameshift, compared to variant 1. The encoded isoform (2) has a distinct C-terminus and is shorter than isoform 1. Variants 2, 3, 4, 5, 6, 7, 8, 9, 10, and 11 encode the isoform 2.