DNAJC15 (NM_013238) Human Untagged Clone

CAT#: SC115339

DNAJC15 (untagged)-Human DnaJ (Hsp40) homolog, subfamily C, member 15 (DNAJC15)


  "NM_013238" in other vectors (6)

Reconstitution Protocol

USD 310.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "DNAJC15"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol DNAJC15
Synonyms DNAJD1; HSD18; MCJ
Vector PCMV6-Neo
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene ORF within SC115339 sequence for NM_013238 edited (data generated by NextGen Sequencing)
ATGGCTGCCCGTGGTGTCATCGCTCCAGTTGGCGAGAGTTTGCGCTACGCTGAGTACTTG
CAGCCCTCGGCCAAACGGCCAGACGCCGACGTCGACCAGCAGAGACTGGTAAGAAGTTTG
ATAGCTGTAGGCCTGGGTGTTGCAGCTCTTGCATTTGCAGGTCGCTACGCATTTCGGATC
TGGAAACCTCTAGAACAAGTTATCACAGAAACTGCAAAGAAGATTTCAACTCCTAGCTTT
TCATCCTACTATAAAGGAGGATTTGAACAGAAAATGAGTAGGCGAGAAGCTGGTCTTATT
TTAGGTGTAAGCCCATCTGCTGGCAAGGCTAAGATTAGAACAGCTCATAGGAGAGTCATG
ATTTTGAATCACCCAGATAAAGGTGGATCTCCTTACGTAGCAGCCAAAATAAATGAAGCA
AAAGACTTGCTAGAAACAACCACCAAACATTGA

Clone variation with respect to NM_013238.2
132 a=>c
Restriction Sites Please inquire     
ACCN NM_013238
ORF Size 453 bp
Insert Size 2500
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_013238.2, NP_037370.2
RefSeq Size 2792
RefSeq ORF 453
Locus ID 29103
Domains DnaJ
Protein Families Transmembrane

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.