Cystatin F (CST7) (NM_003650) Human Untagged Clone

CAT#: SC117836

CST7 (untagged)-Human cystatin F (leukocystatin) (CST7)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CST7
• Synonyms: CMAP
• Vector: pCMV6-XL4
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_003650, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCGAGCGGCTGGAACTCTGCTGGCCTTCTGCTGCCTGGTCTTGAGCACCACTGGGGGCCCTTCCCCAG
  ATACTTGTTCCCAGGACCTTAACTCACGTGTGAAGCCAGGATTTCCTAAAACAATAAAGACCAATGACCC
  AGGAGTCCTCCAAGCAGCCAGATACAGTGTTGAAAAGTTCAACAACTGCACGAACGACATGTTCTTGTTC
  AAGGAGTCCCGCATCACAAGGGCCCTAGTTCAGATAGTGAAAGGCCTGAAATATATGCTGGAGGTGGAAA
  TTGGCAGAACTACCTGCAAGAAAAACCAGCACCTGCGTCTGGATGACTGTGACTTCCAAACCAACCACAC
  CTTGAAGCAGACTCTGAGCTGCTACTCTGAAGTCTGGGTCGTGCCCTGGCTCCAGCACTTCGAGGTGCCT
  GTTCTCCGTTGTCACTGA
  
  
• Restriction Sites: NotI-NotI
• ACCN: NM_003650
• ORF Size: 438 bp
• Insert Size: 1020
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_003650.3, NP_003641.3
• RefSeq Size: 940
• RefSeq ORF: 438
• Locus ID: 8530
• Domains: CY
• Protein Families: Secreted Protein
• Gene Summary: The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. There are three inhibitory families in the superfamily, including the type 1 cystatins (stefins), type 2 cystatins and the kininogens. The type 2 cystatin proteins are a class of cysteine proteinase inhibitors found in a variety of human fluids and secretions. This gene encodes a glycosylated cysteine protease inhibitor with a putative role in immune regulation through inhibition of a unique target in the hematopoietic system. Expression of the protein has been observed in various human cancer cell lines established from malignant tumors. [provided by RefSeq, Jul 2008]