HIST1H2AK (HIST1H2AL) (NM_003511) Human Untagged Clone

CAT#: SC117913

HIST1H2AL (untagged)-Human histone cluster 1, H2al (HIST1H2AL)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: HIST1H2AL
• Synonyms: dJ193B12.9; H2A.i; H2A/i; H2AFI
• Vector: pCMV6-XL4
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene ORF sequence for NM_003511 edited
  ATGTCTGGACGTGGTAAGCAAGGAGGCAAAGCTCGCGCCAAAGCGAAATCCCGCTCTTCT
  CGCGCTGGTCTCCAGTTCCCGGTGGGCCGAGTGCACCGCCTGCTCCGTAAAGGCAACTAC
  GCAGAGCGGGTTGGGGCAGGCGCGCCGGTGTACCTGGCGGCGGTGTTAGAGTACCTGACC
  GCCGAGATCCTGGAGCTGGCCGGCAACGCGGCTCGCGACAACAAGAAGACTCGCATCATC
  CCGCGCCACTTGCAGCTGGCCATCCGCAACGACGAGGAGCTCAACAAACTGCTAGGCCGG
  GTGACCATTGCTCAGGGCGGCGTCCTTCCTAACATCCAGGCCGTGCTTCTGCCTAAGAAG
  ACCGAGAGTCACCACAAGGCCAAGGGCAAGTGA
  
• Restriction Sites: NotI-NotI
• ACCN: NM_003511
• ORF Size: 393 bp
• Insert Size: 4840
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_003511.2, NP_003502.1
• RefSeq Size: 470
• RefSeq ORF: 393
• Locus ID: 8332
• Domains: H2A, histone
• Protein Pathways: Systemic lupus erythematosus
• Gene Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H2A family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. This gene is found in the small histone gene cluster on chromosome 6p22-p21.3. [provided by RefSeq, Aug 2015]