HIST1H2BG (NM_003518) Human Untagged Clone

CAT#: SC117917

HIST1H2BG (untagged)-Human histone cluster 1, H2bg (HIST1H2BG)


  "NM_003518" in other vectors (4)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "HIST1H2BG"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol HIST1H2BG
Synonyms dJ221C16.8; H2B.1A; H2B/a; H2BFA
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_003518, the custom clone sequence may differ by one or more nucleotides


ATGCCTGAACCAGCTAAGTCAGCTCCTGCTCCGAAGAAGGGTTCCAAGAAGGCTGTGACCAAGGCGCAGA
AGAAGGATGGCAAGAAGCGCAAGCGCAGTCGTAAGGAGAGCTACTCCGTGTATGTGTACAAGGTGCTAAA
ACAGGTTCACCCCGATACTGGCATCTCATCCAAGGCCATGGGCATCATGAATTCCTTCGTTAACGACATC
TTCGAACGCATCGCAGGCGAGGCTTCCCGTCTGGCCCACTACAACAAGCGCTCGACCATTACCTCCAGGG
AGATCCAGACCGCCGTGCGTCTGCTGCTTCCCGGAGAGCTGGCCAAGCACGCAGTGTCCGAAGGTACCAA
GGCTGTCACCAAGTATACAAGCTCCAAGTAA


Restriction Sites NotI-NotI     
ACCN NM_003518
ORF Size 381 bp
Insert Size 2170
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_003518.3, NP_003509.1
RefSeq Size 445
RefSeq ORF 381
Locus ID 8339
Domains H2B, histone
Protein Pathways Systemic lupus erythematosus
Gene Summary Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. The protein has antibacterial and antifungal antimicrobial activity. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H2B family. Transcripts from this gene lack polyA tails; instead, they contain a palindromic termination element. This gene is found in the large histone gene cluster on chromosome 6p22-p21.3. [provided by RefSeq, Aug 2015]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.