HIST1H2BG (NM_003518) Human Untagged Clone
CAT#: SC117917
HIST1H2BG (untagged)-Human histone cluster 1, H2bg (HIST1H2BG)
"NM_003518" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | HIST1H2BG |
Synonyms | dJ221C16.8; H2B.1A; H2B/a; H2BFA |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_003518, the custom clone sequence may differ by one or more nucleotides
ATGCCTGAACCAGCTAAGTCAGCTCCTGCTCCGAAGAAGGGTTCCAAGAAGGCTGTGACCAAGGCGCAGA AGAAGGATGGCAAGAAGCGCAAGCGCAGTCGTAAGGAGAGCTACTCCGTGTATGTGTACAAGGTGCTAAA ACAGGTTCACCCCGATACTGGCATCTCATCCAAGGCCATGGGCATCATGAATTCCTTCGTTAACGACATC TTCGAACGCATCGCAGGCGAGGCTTCCCGTCTGGCCCACTACAACAAGCGCTCGACCATTACCTCCAGGG AGATCCAGACCGCCGTGCGTCTGCTGCTTCCCGGAGAGCTGGCCAAGCACGCAGTGTCCGAAGGTACCAA GGCTGTCACCAAGTATACAAGCTCCAAGTAA |
Restriction Sites | NotI-NotI |
ACCN | NM_003518 |
ORF Size | 381 bp |
Insert Size | 2170 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_003518.3, NP_003509.1 |
RefSeq Size | 445 |
RefSeq ORF | 381 |
Locus ID | 8339 |
Domains | H2B, histone |
Protein Pathways | Systemic lupus erythematosus |
Gene Summary | Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. The protein has antibacterial and antifungal antimicrobial activity. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H2B family. Transcripts from this gene lack polyA tails; instead, they contain a palindromic termination element. This gene is found in the large histone gene cluster on chromosome 6p22-p21.3. [provided by RefSeq, Aug 2015] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC210258 | HIST1H2BG (Myc-DDK-tagged)-Human histone cluster 1, H2bg (HIST1H2BG) |
USD 420.00 |
|
RG210258 | HIST1H2BG (GFP-tagged) - Human histone cluster 1, H2bg (HIST1H2BG) |
USD 460.00 |
|
RC210258L3 | Lenti-ORF clone of HIST1H2BG (Myc-DDK-tagged)-Human histone cluster 1, H2bg (HIST1H2BG) |
USD 620.00 |
|
RC210258L4 | Lenti-ORF clone of HIST1H2BG (mGFP-tagged)-Human histone cluster 1, H2bg (HIST1H2BG) |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review