GJA4 (NM_002060) Human Untagged Clone
CAT#: SC118876
GJA4 (untagged)-Human gap junction protein, alpha 4, 37kDa (GJA4)
"NM_002060" in other vectors (7)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | GJA4 |
Synonyms | CX37 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene SC118876 ORF sequence for NM_002060, the custom clone sequence may differ by one or more nucleotides
ATGGGTGACTGGGGCTTCCTGGAGAAGTTGCTGGACCAGGTCCAGGAGCACTCGACCGTGGTGGGTAAGA TCTGGCTGACGGTGCTCTTCATCTTCCGCATCCTCATCCTGGGCCTGGCCGGCGAGTCAGTGTGGGGTGA CGAGCAATCAGATTTCGAGTGTAACACGGCCCAGCCAGGCTGCACCAACGTCTGCTATGACCAGGCCTTC CCCATCTCCCACATCCGCTACTGGGTGCTGCAGTTCCTCTTCGTCAGCACACCCACCCTGGTCTACCTGG GCCATGTCATTTACCTGTCTCGGCGAGAAGAGCGGCTGCGGCAGAAGGAGGGGGAGCTGCGGGCACTGCC GGCCAAGGACCCACAGGTGGAGCGGGCGCTGGCGGCCGTAGAGCGTCAGATGGCCAAGATCTCGGTGGCA GAAGATGGTCGCCTGCGCATCCGCGGAGCACTGATGGGCACCTATGTCGCCAGTGTGCTCTGCAAGAGTG TGCTAGAGGCAGGCTTCCTCTATGGCCAGTGGCGCCTGTACGGCTGGACCATGGAGCCCGTGTTTGTGTG CCAGCGAGCACCCTGCCCCTACCTCGTGGACTGCTTTGTCTCTCGCCCCACGGAGAAGACCATCTTCATC ATCTTCATGTTGGTGGTTGGACTCATCTCCCTGGTGCTTAACCTGCTGGAGTTGGTGCACCTGCTGTGTC GCTGCCTCAGCCGGGGGATGAGGGCACGGCAAGGCCAAGACGCACCCCCGACCCAGGGCACCTCCTCAGA CCCTTACACGGACCAGGTCTTCTTCTACCTCCCCGTGGGCCAGGGGCCCTCATCCCCACCATGCCCCACC TACAATGGGCTCTCATCCAGTGAGCAGAACTGGGCCAACCTGACCACAGAGGAGAGGCTGGCGTCTTCCA GGCCCCCTCTCTTCCTGGACCCACCCCCTCAGAATGGCCAAAAACCCCCAAGTCGTCCCAGCAGCTCTGC TTCTAAGAAGCAGTATGTATAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_002060 |
Insert Size | 3750 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_002060.2, NP_002051.2 |
RefSeq Size | 1710 bp |
RefSeq ORF | 1002 bp |
Locus ID | 2701 |
Cytogenetics | 1p34.3 |
Domains | CNX |
Protein Families | Ion Channels: Other, Transmembrane |
Gene Summary | 'This gene encodes a member of the connexin gene family. The encoded protein is a component of gap junctions, which are composed of arrays of intercellular channels that provide a route for the diffusion of low molecular weight materials from cell to cell. Mutations in this gene have been associated with atherosclerosis and a higher risk of myocardial infarction. [provided by RefSeq, Jul 2008]' |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
SC322021 | GJA4 (untagged)-Human gap junction protein, alpha 4, 37kDa (GJA4) |
USD 760.00 |
|
RC209952 | GJA4 (Myc-DDK-tagged)-Human gap junction protein, alpha 4, 37kDa (GJA4) |
USD 420.00 |
|
RG209952 | GJA4 (GFP-tagged) - Human gap junction protein, alpha 4, 37kDa (GJA4) |
USD 460.00 |
|
RC209952L1 | Lenti ORF clone of Human gap junction protein, alpha 4, 37kDa (GJA4), Myc-DDK-tagged |
USD 768.00 |
|
RC209952L2 | Lenti ORF clone of Human gap junction protein, alpha 4, 37kDa (GJA4), mGFP tagged |
USD 620.00 |
|
RC209952L3 | Lenti ORF clone of Human gap junction protein, alpha 4, 37kDa (GJA4), Myc-DDK-tagged |
USD 620.00 |
|
RC209952L4 | Lenti ORF clone of Human gap junction protein, alpha 4, 37kDa (GJA4), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review