CKS1 (CKS1B) (NM_001826) Human Untagged Clone

CAT#: SC119010

CKS1B (untagged)-Human CDC28 protein kinase regulatory subunit 1B (CKS1B), transcript variant 1


  "NM_001826" in other vectors (6)

Reconstitution Protocol

USD 310.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "CKS1B"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CKS1B
Synonyms CKS1; ckshs1; PNAS-16; PNAS-18
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_001826 edited
ATGTCGCACAAACAAATTTACTATTCGGACAAATACGACGACGAGGAGTTTGAGTATCGA
CATGTCATGCTGCCCAAGGACATAGCCAAGCTGGTCCCTAAAACCCATCTGATGTCTGAA
TCTGAATGGAGGAATCTTGGCGTTCAGCAGAGTCAGGGATGGGTCCATTATATGATCCAT
GAACCAGAACCTCACATCTTGCTGTTCCGGCGCCCACTACCCAAGAAACCAAAGAAATGA
>OriGene 5' read for NM_001826 unedited
TAGATTTGTATACGACNACTATAGGCGGCCGCGNAATTCGCACGAGGGTTGGGAGTTGCT
TGGAGGTTGGCGGCGCGGGGCTGAAGGCTAGCAAACCGAGCGATCATGTCGCACAAACAA
ATTTACTATTCGGACAAATACGACGACGAGGAGTTTGAGTATCGACATGTCATGCTGCCC
AAGGACATAGCCAAGCTGGTCCCTAAAACCCATCTGATGTCTGAATCTGAATGGAGGAAT
CTTGGCGTTCAGCAGAGTCAGGGATGGGTCCATTATATGATCCATGAACCAGAACCTCAC
ATCTTGCTGTTCCGGCGCCCACTACCCAAGAAACCAAAGAAATGAAGCTGGCAAGCTACT
TTTCAGCCTCAAGCTTTACACAGCTGTCCTTACTTCCTAACATCTTTCTGATAACATTAT
TATGTTGCCTTCTTGTTTCTCACTTTGATATTTAAAAGATGTTCAATACACTGTTTGAAT
GTGCTGGTAACTGCTTTGCTTCTTGAGTAGAGCCACCACCACCATAGCCCAGCCAGATGA
GTGCTCTGTGGACCCACAGCCTAAGCTGAGTGTGACCCCAGAAGCCACGATGTGCTCTGT
ATCCAGAACACACTTGGCAGATGGAGGAAGCATCTGAGTTTGAGACCATGGCTGTTACAG
GGATCATGTAAACTTGCTGTTTTTGTTTTTTCCTGCCGGGTGTTGTATGTGTGGTGACTT
GCGGATTTATGTTTCAGTGTACTGGAAACTTTNCATTNTATTCAAGAAATCTGTTCATGT
TAAAAGCCTTGATTAAAGAGGAAGTTTTTATAATCTAGTGCTGTAATTGTACGGGTTTTT
TTCCCCTCACTCAGGGTGAGCATCATCAATATCATGGGTCTAANTATATGCCCCTTNCAG
TTGATAATGAAGCTCAGCTCTTTGCTGATAATGAGGGTTAACATTGAGATACTGGNTT
Restriction Sites NotI-NotI     
ACCN NM_001826
Insert Size 2630 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001826.1, NP_001817.1
RefSeq Size 717 bp
RefSeq ORF 240 bp
Locus ID 1163
Cytogenetics 1q21.3
Domains CKS
Protein Families Druggable Genome, Stem cell - Pluripotency
Protein Pathways Pathways in cancer, Small cell lung cancer
Gene Summary 'CKS1B protein binds to the catalytic subunit of the cyclin dependent kinases and is essential for their biological function. The CKS1B mRNA is found to be expressed in different patterns through the cell cycle in HeLa cells, which reflects a specialized role for the encoded protein. At least two transcript variants have been identified for this gene, and it appears that only one of them encodes a protein. [provided by RefSeq, Sep 2008]'
Transcript Variant: This variant (1) is the protein-coding variant.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.