RPS9 (NM_001013) Human Untagged Clone

CAT#: SC119521

RPS9 (untagged)-Human ribosomal protein S9 (RPS9)


  "NM_001013" in other vectors (7)

Reconstitution Protocol

USD 310.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "RPS9"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RPS9
Synonyms S9
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF within SC119521 sequence for NM_001013 edited (data generated by NextGen Sequencing)
ATGCCAGTGGCCCGGAGCTGGGTTTGTCGCAAAACTTATGTGACCCCGCGGAGACCCTTC
GAGAAATCTCGTCTCGACCAAGAGCTGAAGCTGATCGGCGAGTATGGGCTCCGGAACAAA
CGTGAGGTCTGGAGGGTCAAATTTACCCTGGCCAAGATCCGCAAGGCCGCCCGGGAACTG
CTGACGCTTGATGAGAAGGACCCACGGCGTCTGTTCGAAGGCAACGCCCTGCTGCGGCGG
CTGGTCCGCATTGGGGTGCTGGATGAGGGCAAGATGAAGCTGGATTACATCCTGGGCCTG
AAGATAGAGGATTTCTTAGAGAGACGCCTGCAGACCCAGGTCTTCAAGCTGGGCTTGGCC
AAGTCCATCCACCACGCTCGCGTGCTGATCCGCCAGCGCCATATCAGGGTCCGCAAGCAG
GTGGTGAACATCCCGTCCTTCATTGTCCGCCTGGATTCCCAGAAGCACATCGACTTCTCT
CTGCGCTCTCCCTACGGGGGTGGCCGCCCGGGCCGCGTGAAGAGGAAGAATGCCAAGAAG
GGCCAGGGTGGGGCTGGGGCTGGAGACGACGAGGAGGAGGATTAA

Clone variation with respect to NM_001013.3
>OriGene 5' read for NM_001013 unedited
CACGAGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATGCCAGTGGCCCGG
AGCTGGGTTTGTCGCAAAACTTATGTGACCCCGCGGAGACCCTTCGAGAAATCTCGTCTC
GACCAAGAGCTGAAGCTGATCGGCGAGTATGGGCTCCGGAACAAACGTGAGGTCTGGAGG
GTCAAATTTACCCTGGCCAAGATCCGCAAGGCCGCCCGGGAACTGCTGACGCTTGATGAG
AAGGACCCACGGCGTCTGTTCGAAGGCAACGCCCTGCTGCGGCGGCTGGTCCGCATTGGG
GTGCTGGATGAGGGCAAGATGAAGCTGGATTACATCCTGGGCCTGAAGATAGAGGATTTC
TTAGAGAGACGCCTGCAGACCCAGGTCTTCAAGCTGGGCTTGGCCAAGTCCATCCACCAC
GCTCGCGTGCTGATCCGCCAGCGCCATATCAGGGTCCGCAAGCAGGTGGTGAACATCCCG
TCCTTCATTGTCCGCCTGGATTCCCAGAAGCACATCGACTTCTCTCTGCGCTCTCCCTAC
Restriction Sites NotI-NotI     
ACCN NM_001013
Insert Size 690 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001013.3, NP_001004.2
RefSeq Size 753 bp
RefSeq ORF 585 bp
Locus ID 6203
Cytogenetics 19q13.42
Domains Ribosomal_S4, S4
Protein Pathways Ribosome
Gene Summary 'Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S4P family of ribosomal proteins. It is located in the cytoplasm. Variable expression of this gene in colorectal cancers compared to adjacent normal tissues has been observed, although no correlation between the level of expression and the severity of the disease has been found. As is typical for genes encoding ribosomal proteins, multiple processed pseudogenes derived from this gene are dispersed through the genome. [provided by RefSeq, Jul 2008]'
Transcript Variant: This variant (1), as well as variants 2, 3, and 4, encodes isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.