SAT2 (NM_133491) Human Untagged Clone

CAT#: SC120524

SAT2 (untagged)-Human spermidine/spermine N1-acetyltransferase family member 2 (SAT2)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SAT2
• Synonyms: SSAT2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_133491, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCTTCCGTGCGGATCCGAGAGGCCAAGGAGGGAGACTGTGGAGATATCCTGAGGCTGATTCGGGAGC
  TAGCCGAATTCGAAAAACTCTCGGATCAGGTGAAGATCAGTGAAGAAGCCCTGAGAGCAGATGGCTTTGG
  AGACAATCCTTTCTATCACTGTTTGGTAGCAGAGATTCTTCCAGCGCCCGGGAAGCTACTGGGGCCCTGC
  GTGGTGGGCTATGGGATATACTATTTCATCTACAGTACATGGAAGGGACGCACCATTTATCTGGAGGATA
  TCTATGTGATGCCGGAATATCGGGGTCAAGGGATTGGTTCCAAAATAATCAAAAAGGTGGCTGAGGTGGC
  CTTGGATAAGGGCTGCTCCCAATTCCGCCTGGCCGTCCTGGACTGGAACCAGAGGGCCATGGACTTGTAC
  AAGGCCCTAGGAGCCCAAGATCTGACGGAAGCTGAGGGCTGGCACTTCTTCTGCTTTCAAGGAGAGGCAA
  CGAGAAAGTTGGCAGGAAAGTGA
  
  
• Restriction Sites: NotI-NotI
• ACCN: NM_133491
• ORF Size: 513 bp
• Insert Size: 1650
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info

Reference Data

• RefSeq: NM_133491.2, NP_597998.1
• RefSeq Size: 953
• RefSeq ORF: 513
• Locus ID: 112483
• Domains: Acetyltransf
• Protein Pathways: Arginine and proline metabolism, Metabolic pathways
• Gene Summary: Enzyme which catalyzes the acetylation of polyamines. Substrate specificity: norspermidine > spermidine = spermine >> N(1)acetylspermine = putrescine. [UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (3) uses an alternate 5' terminal exon, resulting in a novel 5' UTR and the use of an alternate start codon, compared to variant 1. The encoded isoform (3) has a distinct N-terminus, and is shorter than isoform 1.