CLEC1B (NM_016509) Human Untagged Clone

CAT#: SC122848

CLEC1B (untagged)-Human C-type lectin domain family 1, member B (CLEC1B), transcript variant 1


  "NM_016509" in other vectors (4)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "CLEC1B"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CLEC1B
Synonyms 1810061I13Rik; CLEC2; CLEC2B; PRO1384; QDED721
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_016509, the custom clone sequence may differ by one or more nucleotides


ATGCAGGATGAAGATGGATACATCACCTTAAATATTAAAACTCGGAAACCAGCTCTCATCTCCGTTGGCT
CTGCATCCTCCTCCTGGTGGCGTGTGATGGCTTTGATTCTGCTGATCCTGTGCGTGGGGATGGTTGTCGG
GCTGGTGGCTCTGGGGATTTGGTCTGTCATGCAGCGCAATTACCTACAAGGTGAGAATGAAAATCGCACA
GGAACTCTGCAACAATTAGCAAAGCGCTTCTGTCAATATGTGGTAAAACAATCAGAACTAAAGGGCACTT
TCAAAGGTCATAAATGCAGCCCCTGTGACACAAACTGGAGATATTATGGAGATAGCTGCTATGGGTTCTT
CAGGCACAACTTAACATGGGAAGAGAGTAAGCAGTACTGCACTGACATGAATGCTACTCTCCTGAAGATT
GACAACCGGAACATTGTGGAGTACATCAAAGCCAGGACTCATTTAATTCGTTGGGTCGGATTATCTCGCC
AGAAGTCGAATGAGGTCTGGAAGTGGGAGGATGGCTCGGTTATCTCAGAAAATATGTTTGAGTTTTTGGA
AGATGGAAAAGGAAATATGAATTGTGCTTATTTTCATAATGGGAAAATGCACCCTACCTTCTGTGAGAAC
AAACATTATTTAATGTGTGAGAGGAAGGCTGGCATGACCAAGGTGGACCAACTACCTTAA


Restriction Sites Please inquire     
ACCN NM_016509
ORF Size 690 bp
Insert Size 945
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_016509.2, NP_057593.2
RefSeq Size 963
RefSeq ORF 690
Locus ID 51266
Protein Families Druggable Genome, Transmembrane
Gene Summary Natural killer (NK) cells express multiple calcium-dependent (C-type) lectin-like receptors, such as CD94 (KLRD1; MIM 602894) and NKG2D (KLRC4; MIM 602893), that interact with major histocompatibility complex class I molecules and either inhibit or activate cytotoxicity and cytokine secretion. CLEC2 is a C-type lectin-like receptor expressed in myeloid cells and NK cells (Colonna et al., 2000 [PubMed 10671229]). [supplied by OMIM, Jan 2011]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (a).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.