Kallikrein 12 (KLK12) (NM_145894) Human Untagged Clone

CAT#: SC125565

KLK12 (untagged)-Human kallikrein-related peptidase 12 (KLK12), transcript variant 2


  "NM_145894" in other vectors (6)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "KLK12"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol KLK12
Synonyms KLK-L5; KLKL5
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_145894, the custom clone sequence may differ by one or more nucleotides


ATGGGGCTCAGCATCTTTTTGCTCCTGTGTGTTCTTGGGCTCAGCCAGGCAGCCACACCGAAGATTTTCA
ATGGCACTGAGTGTGGGCGTAACTCACAGCCGTGGCAGGTGGGGCTGTTTGAGGGCACCAGCCTGCGCTG
CGGGGGTGTCCTTATTGACCACAGGTGGGTCCTCACAGCGGCTCACTGCAGCGGCAGCAGGTACTGGGTG
CGCCTGGGGGAACACAGCCTCAGCCAGCTCGACTGGACCGAGCAGATCCGGCACAGCGGCTTCTCTGTGA
CCCATCCCGGCTACCTGGGAGCCTCGACGAGCCACGAGCACGACCTCCGGCTGCTGCGGCTGCGCCTGCC
CGTCCGCGTAACCAGCAGCGTTCAACCCCTGCCCCTGCCCAATGACTGTGCAACCGCTGGCACCGAGTGC
CACGTCTCAGGCTGGGGCATCACCAACCACCCACGGAACCCATTCCCGGATCTGCTCCAGTGCCTCAACC
TCTCCATCGTCTCCCATGCCACCTGCCATGGTGTGTATCCCGGGAGAATCACGAGCAACATGGTGTGTGC
AGGCGGCGTCCCGGGGCAGGATGCCTGCCAGGGTGATTCTGGGGGCCCCCTGGTGTGTGGGGGAGTCCTT
CAAGGTCTGGTGTCCTGGGGGTCTGTGGGGCCCTGTGGACAAGATGGCATCCCTGGAGTCTACACCTATA
TTTGCAAGTATGTGGACTGGATCCGGATGATCATGAGGAACAACTGA


Restriction Sites Please inquire     
ACCN NM_145894
ORF Size 747 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_145894.1, NP_665901.1
RefSeq Size 1074
RefSeq ORF 747
Locus ID 43849
Protein Families Druggable Genome, Protease, Secreted Protein
Gene Summary Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Alternate splicing of this gene results in three transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) uses alternate splice sites in the 3' coding region, as compared to variant 1. Isoform 2 has a distinct C-terminus compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.