Pancreatic Polypeptide (PPY) (BC032225) Human Untagged Clone

CAT#: SC126039

PPY (untagged)-Human pancreatic polypeptide (cDNA clone MGC:34568 IMAGE:5229163), complete cds

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PPY
• Synonyms: PNP; PP
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for BC032225 edited
  ATGGCTGCCGCACGCCTCTGCCTCTCCCTGCTGCTCCTGTCCACCTGCGTGGCTCTGTTA
  CTACAGCCACTGCTGGGTGCCCAGGGAGCCCCACTGGAGCCAGTGTACCCAGGGGACAAT
  GCCACACCAGAGCAGATGGCCCAGTATGCAGCTGATCTCCGTAGATACATCAACATGCTG
  ACCAGGCCTAGGTATGGGAAAAGACACAAAGAGGACACGCTGGCCTTCTCGGAGTGGGGG
  TCCCCGCATGCTGCTGTCCCCAGGGAGCTCAGCCCGCTGGACTTATAATGCCACCTTCTG
  TCTCCTACGACTCCATGAGCAGCGCCAGCCCAGCTCTCCCCTCTGCACCCTTGGCTCTGG
  CCAAAGCTTGCTCCCTGCTCCCACACAGGCTCAATAAAGCAAGTCAAAGCCAAAAAAAAA
  AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  
• Restriction Sites: Please inquire
• ACCN: BC032225
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: BC032225.2, AAH32225.1
• RefSeq Size: 527 bp
• Locus ID: 5539
• Cytogenetics: 17q21.31
• Protein Families: Secreted Protein
• Gene Summary: 'This gene encodes a member of the neuropeptide Y (NPY) family of peptides. The encoded 95 aa preproprotein is synthesized in the pancreatic islets of Langerhans and proteolytically processed to generate two peptide products. These products include the active pancreatic hormone of 36 aa and an icosapeptide of unknown function. This hormone acts as a regulator of pancreatic and gastrointestinal functions and may be important in the regulation of food intake. Plasma level of this hormone has been shown to be reduced in conditions associated with increased food intake and elevated in anorexia nervosa. In addition, infusion of this hormone in obese rodents has shown to decrease weight gain. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Jan 2016]'