LD78 beta (CCL3L1) (NM_021006) Human Untagged Clone

CAT#: SC127623

CCL3L1 (untagged)-Human chemokine (C-C motif) ligand 3-like 1 (CCL3L1)


  "NM_021006" in other vectors (6)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "CCL3L1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CCL3L1
Synonyms 464.2; D17S1718; G0S19-2; LD78; LD78-beta(1-70); LD78BETA; MIP1AP; SCYA3L; SCYA3L1
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF within SC127623 sequence for NM_021006 edited (data generated by NextGen Sequencing)
ATGCAGGTCTCCACTGCTGCCCTTGCCGTCCTCCTCTGCACCATGGCTCTCTGCAACCAG
GTCCTCTCTGCACCACTTGCTGCTGACACGCCGACCGCCTGCTGCTTCAGCTACACCTCC
CGACAGATTCCACAGAATTTCATAGCTGACTACTTTGAGACGAGCAGCCAGTGCTCCAAG
CCCAGTGTCATCTTCCTAACCAAGAGAGGCCGGCAGGTCTGTGCTGACCCCAGTGAGGAG
TGGGTCCAGAAATACGTCAGTGACCTGGAGCTGAGTGCCTGA

Clone variation with respect to NM_021006.4
>OriGene 5' read for NM_021006 unedited
NNCCCGTCAGAATTTGTAAACGACTCACTATAGGCGGCCGCGNAATCCCGGGNTGCAGCA
AAGATAGTCAGTCCCTTCTTGGCTCTGCTGACACTCGAGCCCACATTCCATCACCTGCTC
CCAATCATGCAGGTCTCCACTGCTGCCCTTGCCGTCCTCCTCTGCACCATGGCTCTCTGC
AACCAGGTCCTCTCTGCACCACTTGCTGCTGACACGCCGACCGCCTGCTGCTTCAGCTAC
ACCTCCCGACAGATTCCACAGAATTTCATAGCTGACTACTTTGAGACGAGCAGCCAGTGC
TCCAAGCCCAGTGTCATCTTCCTAACCAAGAGAGGCCGGCAGGTCTGTGCTGACCCCAGT
GAGGAGTGGGTCCAGAAATACGTCAGTGACCTGGAGCTGAGTGCCTGAGGGGTCCAGAAG
CTTCGAGGCCCAGCGACCTCAGTGGGCCCAGTGGGGAGGAGCAGGAGCCTGAGCCTTGGG
AACATGCGTGTGACCTCTACAGCTACCTCTTCTATGGACTGGTTATTGCCAAACAGCCAC
ACTGTGGGACTCTTCTTAACTTAAATTTTAATTTATTTATACTATTTAGTTTTTATAATT
TATTTTTGATTTCACAGTGTGTTTGTGATTGTTTGCTCTGAGAGTTCCCCCTGTCCCCTC
CACCTTCCCTCACAGTGTGTCTGGTGACGACCGAGTGGCTGTCATCGGCCTGTGTAGGCA
GTCATGGCACCAAAGCCACCAGACTGACAAATGTGTATCAGATGCTTTTGTTCAGGGCTG
TGATCGGCCTGGGGAAATATAAAGATGTTCTTTTAAACGGTAAAAAAAAAAAAAAAAAAA
AAAGGGCGCCCGCGTCATAGCTGTTTCCTGAACGATCCCGGTGGCATCCCTGG
Restriction Sites Please inquire     
ACCN NM_021006
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_021006.4, NP_066286.1
RefSeq Size 804 bp
RefSeq ORF 282 bp
Locus ID 6349
Cytogenetics 17q21.1
Protein Families Druggable Genome, Secreted Protein
Protein Pathways Chemokine signaling pathway, Cytokine-cytokine receptor interaction
Gene Summary 'This gene is one of several cytokine genes that are clustered on the q-arm of chromosome 17. Cytokines are a family of secreted proteins that function in inflammatory and immunoregulatory processes. The protein encoded by this gene binds to several chemokine receptors, including chemokine binding protein 2 and chemokine (C-C motif) receptor 5 (CCR5). CCR5 is a co-receptor for HIV, and binding of this protein to CCR5 inhibits HIV entry. The copy number of this gene varies among individuals, where most individuals have one to six copies, and a minority of individuals have zero or more than six copies. There are conflicting reports about copy number variation of this gene and its correlation to disease susceptibility. This record represents one of two copies that are present on the ALT_REF_LOCI_2 alternate haplotype of the GRCh38 human reference genome assembly. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2014]'
Transcript Variant: This variant (1) represents the shorter transcript but encodes the supported protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.