IL9 (NM_000590) Human Untagged Clone

CAT#: SC300105

IL9 (untagged)-Human interleukin 9 (IL9)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: IL9
• Synonyms: HP40; IL-9; P40
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_000590 edited
  CCGCTGTCAAGATGCTTCTGGCCATGGTCCTTACCTCTGCCCTGCTCCTGTGCTCCGTGG
  CAGGCCAGGGGTGTCCAACCTTGGCGGGGATCCTGGACATCAACTTCCTCATCAACAAGA
  TGCAGGAAGATCCAGCTTCCAAGTGCCACTGCAGTGCTAATGTGACCAGTTGTCTCTGTT
  TGGGCATTCCCTCTGACAACTGCACCAGACCATGCTTCAGTGAGAGACTGTCTCAGATGA
  CCAATACCACCATGCAAACAAGATACCCACTGATTTTCAGTCGGGTGAAAAAATCAGTTG
  AAGTACTAAAGAACAACAAGTGTCCATATTTTTCCTGTGAACAGCCATGCAACCAAACCA
  CGGCAGGCAACGCGCTGACATTTCTGAAGAGTCTTCTGGAAATTTTCCAGAAAGAAAAGA
  TGAGAGGGATGAGAGGCAAGATATGAAGATGAAA
  
• Restriction Sites: Please inquire
• ACCN: NM_000590
• ORF Size: 435 bp
• Insert Size: 500
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: The ORF of this clone has been fully sequenced and found to be a perfect match to NM_000590.1.

Reference Data

• RefSeq: NM_000590.1, NP_000581.1
• RefSeq Size: 591
• RefSeq ORF: 435
• Locus ID: 3578
• Protein Families: Druggable Genome, Secreted Protein
• Protein Pathways: Asthma, Cytokine-cytokine receptor interaction, Jak-STAT signaling pathway
• Gene Summary: The protein encoded by this gene is a cytokine that acts as a regulator of a variety of hematopoietic cells. This cytokine stimulates cell proliferation and prevents apoptosis. It functions through the interleukin 9 receptor (IL9R), which activates different signal transducer and activator (STAT) proteins and thus connects this cytokine to various biological processes. The gene encoding this cytokine has been identified as a candidate gene for asthma. Genetic studies on a mouse model of asthma demonstrated that this cytokine is a determining factor in the pathogenesis of bronchial hyperresponsiveness. [provided by RefSeq, Jul 2008]