AIRE (NM_000658) Human Untagged Clone

CAT#: SC300116

AIRE (untagged)-Human autoimmune regulator (AIRE), transcript variant AIRE-2


  "NM_000658" in other vectors (4)

Reconstitution Protocol

USD 760.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "AIRE"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol AIRE
Synonyms AIRE1; APECED; APS1; APSI; PGA1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_000658, the custom clone sequence may differ by one or more nucleotides


ATGTGGTTGGTGTACAGTTCCGGGGCCCCTGGAACGCAGCAGCCTGCAAGAAACCGGGTTTTCTTCCCAA
TAGGGATGGCCCCGGGGGGTGTCTGTTGGAGACCAGATGGATGGGGAACAGGTGGTCAGGGCAGAATTTC
AGGCCCTGGCAGCATGGGAGCAGGGCAGAGACTGGGGAGTTCAGGTACCCAGAGATGCTGCTGGGGGAGC
TGTTTTGGGAAGGAGGTGGCTCTCAGGAGGGTGCTGCACCCCAGCCCAGTCTGCATGGGCGTCTCTTGCC
TGTGCCAGAAGAATGAGGACGAGTGTGCCGTGTGTCGGGACGGCGGGGAGCTCATCTGCTGTGACGGCTG
CCCTCGGGCCTTCCACCTGGCCTGCCTGTCCCCTCCGCTCCGGGAGATCCCCAGTGGGACCTGGAGGTGC
TCCAGCTGCCTGCAGGCAACAGTCCAGGAGGTGCAGCCCCGGGCAGAGGAGCCCCGGCCCCAGGAGCCAC
CCGTGGAGACCCCGCTCCCCCCGGGGCTTAGGTCGGCGGGAGAGGAGGTAAGAGGTCCACCTGGGGAACC
CCTAGCCGGCATGGACACGACTCTTGTCTACAAGCACCTGCCGGCTCCGCCTTCTGCAGCCCCGCTGCCA
GGGCTGGACTCCTCGGCCCTGCACCCCCTACTGTGTGTGGGTCCTGAGGGTCAGCAGAACCTGGCTCCTG
GTGCGCGTTGCGGGGTGTGCGGAGATGGTACGGACGTGCTGCGGTGTACTCACTGCGCCGCTGCCTTCCA
CTGGCGCTGCCACTTCCCAGCCGGCACCTCCCGGCCCGGGACGGGCCTGCGCTGCAGATCCTGCTCAGGA
GACGTGACCCCAGCCCCTGTGGAGGGGGTGCTGGCCCCCAGCCCCGCCCGCCTGGCCCCTGGGCCTGCCA
AGGATGACACTGCCAGTCACGAGCCCGCTCTGCACAGGGATGACCTGGAGTCCCTTCTGAGCGAGCACAC
CTTCGATGGCATCCTGCAGTGGGCCATCCAGAGCATGGCCCGTCCGGCGGCCCCCTTCCCCTCCTGA


Restriction Sites SgfI-MluI     
ACCN NM_000658
Insert Size 6000 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_000658.2, NP_000649.1
RefSeq Size 1963 bp
RefSeq ORF 1047 bp
Locus ID 326
Cytogenetics 21q22.3
Protein Families Druggable Genome
Protein Pathways Primary immunodeficiency, Ubiquitin mediated proteolysis
Gene Summary 'This gene encodes a transcriptional regulator that forms nuclear bodies and interacts with the transcriptional coactivator CREB binding protein. The encoded protein plays an important role in immunity by regulating the expression of autoantigens and negative selection of autoreactive T-cells in the thymus. Mutations in this gene cause the rare autosomal-recessive systemic autoimmune disease termed autoimmune polyendocrinopathy with candidiasis and ectodermal dystrophy (APECED). [provided by RefSeq, Jun 2012]'
Transcript Variant: This variant (2) lacks several 5' coding segments and uses different sequence for its 5' UTR, compared to variant 1. The resulting protein (isoform 2) has a shorter and distinct N-terminus when it is compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.