AIRE (NM_000658) Human Untagged Clone
CAT#: SC300116
AIRE (untagged)-Human autoimmune regulator (AIRE), transcript variant AIRE-2
"NM_000658" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | AIRE |
Synonyms | AIRE1; APECED; APS1; APSI; PGA1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_000658, the custom clone sequence may differ by one or more nucleotides
ATGTGGTTGGTGTACAGTTCCGGGGCCCCTGGAACGCAGCAGCCTGCAAGAAACCGGGTTTTCTTCCCAA TAGGGATGGCCCCGGGGGGTGTCTGTTGGAGACCAGATGGATGGGGAACAGGTGGTCAGGGCAGAATTTC AGGCCCTGGCAGCATGGGAGCAGGGCAGAGACTGGGGAGTTCAGGTACCCAGAGATGCTGCTGGGGGAGC TGTTTTGGGAAGGAGGTGGCTCTCAGGAGGGTGCTGCACCCCAGCCCAGTCTGCATGGGCGTCTCTTGCC TGTGCCAGAAGAATGAGGACGAGTGTGCCGTGTGTCGGGACGGCGGGGAGCTCATCTGCTGTGACGGCTG CCCTCGGGCCTTCCACCTGGCCTGCCTGTCCCCTCCGCTCCGGGAGATCCCCAGTGGGACCTGGAGGTGC TCCAGCTGCCTGCAGGCAACAGTCCAGGAGGTGCAGCCCCGGGCAGAGGAGCCCCGGCCCCAGGAGCCAC CCGTGGAGACCCCGCTCCCCCCGGGGCTTAGGTCGGCGGGAGAGGAGGTAAGAGGTCCACCTGGGGAACC CCTAGCCGGCATGGACACGACTCTTGTCTACAAGCACCTGCCGGCTCCGCCTTCTGCAGCCCCGCTGCCA GGGCTGGACTCCTCGGCCCTGCACCCCCTACTGTGTGTGGGTCCTGAGGGTCAGCAGAACCTGGCTCCTG GTGCGCGTTGCGGGGTGTGCGGAGATGGTACGGACGTGCTGCGGTGTACTCACTGCGCCGCTGCCTTCCA CTGGCGCTGCCACTTCCCAGCCGGCACCTCCCGGCCCGGGACGGGCCTGCGCTGCAGATCCTGCTCAGGA GACGTGACCCCAGCCCCTGTGGAGGGGGTGCTGGCCCCCAGCCCCGCCCGCCTGGCCCCTGGGCCTGCCA AGGATGACACTGCCAGTCACGAGCCCGCTCTGCACAGGGATGACCTGGAGTCCCTTCTGAGCGAGCACAC CTTCGATGGCATCCTGCAGTGGGCCATCCAGAGCATGGCCCGTCCGGCGGCCCCCTTCCCCTCCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_000658 |
Insert Size | 6000 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_000658.2, NP_000649.1 |
RefSeq Size | 1963 bp |
RefSeq ORF | 1047 bp |
Locus ID | 326 |
Cytogenetics | 21q22.3 |
Protein Families | Druggable Genome |
Protein Pathways | Primary immunodeficiency, Ubiquitin mediated proteolysis |
Gene Summary | 'This gene encodes a transcriptional regulator that forms nuclear bodies and interacts with the transcriptional coactivator CREB binding protein. The encoded protein plays an important role in immunity by regulating the expression of autoantigens and negative selection of autoreactive T-cells in the thymus. Mutations in this gene cause the rare autosomal-recessive systemic autoimmune disease termed autoimmune polyendocrinopathy with candidiasis and ectodermal dystrophy (APECED). [provided by RefSeq, Jun 2012]' Transcript Variant: This variant (2) lacks several 5' coding segments and uses different sequence for its 5' UTR, compared to variant 1. The resulting protein (isoform 2) has a shorter and distinct N-terminus when it is compared to isoform 1. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC216971 | AIRE (Myc-DDK-tagged)-Human autoimmune regulator (AIRE), transcript variant AIRE-2 |
USD 420.00 |
|
RG216971 | AIRE (GFP-tagged) - Human autoimmune regulator (AIRE), transcript variant AIRE-2 |
USD 460.00 |
|
RC216971L3 | Lenti ORF clone of Human autoimmune regulator (AIRE), transcript variant AIRE-2, Myc-DDK-tagged |
USD 620.00 |
|
RC216971L4 | Lenti ORF clone of Human autoimmune regulator (AIRE), transcript variant AIRE-2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review