LCN9 (NM_001001676) Human Untagged Clone

CAT#: SC300260

LCN9 (untagged)-Human lipocalin 9 (LCN9)


  "NM_001001676" in other vectors (4)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "LCN9"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol LCN9
Synonyms HEL129
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_001001676 edited
ATGGCTCTGCTTCTGCTGAGCCTGGGGCTGAGCCTCATCGCAGCCCAGGAGTTCGATCCC
CACACCGTTATGCAGAGGAACTACAACGTGGCCAGGGTTTCAGGGGTCTGGTATTCTATT
TTCATGGCCTCAGATGACCTGAATCGGATTAAAGAAAATGGAGACCTGAGGGTCTTCGTC
CGGAATATTGAACACTTGAAGAACGGCAGCCTAATATTTGATTTCGAATACATGGTGCAG
GGGGAGTGTGTGGCTGTGGTCGTGGTCTGCGAGAAGACAGAGAAGAATGGGGAATACTCC
ATCAACTATGAGGGCCAGAACACAGTGGCCGTCTCGGAGACTGACTACAGGCTGTTCATC
ACCTTCCACCTCCAGAACTTCAGGAACGGGACCGAGACCCACACGCTGGCGCTCTATGAA
ACCTGCGAAAAGTACGGACTTGGCTCACAAAATATCATCGACTTGACCAACAAAGATCCC
TGCTACTCCAAGCATTACAGGAGCCCGCCCAGGCCTCCCATGCGGTGGTAA
Restriction Sites Please inquire     
ACCN NM_001001676
ORF Size 531 bp
Insert Size 530
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001001676.1.
Reference Data
RefSeq NM_001001676.1, NP_001001676.1
RefSeq Size 531
RefSeq ORF 531
Locus ID 392399
Protein Families Secreted Protein
Gene Summary Members of the lipocalin family, such as LCN9, have a common structure consisting of an 8-stranded antiparallel beta-barrel that forms a cup-shaped ligand-binding pocket or calyx. Lipocalins generally bind small hydrophobic ligands and transport them to specific cells (Suzuki et al., 2004 [PubMed 15363845]). [supplied by OMIM, Aug 2009]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.