Kallikrein 2 (KLK2) (NM_001002231) Human Untagged Clone

CAT#: SC300404

KLK2 (untagged)-Human kallikrein-related peptidase 2 (KLK2), transcript variant 2


  "NM_001002231" in other vectors (4)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "KLK2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol KLK2
Synonyms hGK-1; hK2; KLK2A2
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_001002231 edited
ATGTGGGACCTGGTTCTCTCCATCGCCTTGTCTGTGGGGTGCACTGGTGCCGTGCCCCTC
ATCCAGTCTCGGATTGTGGGAGGCTGGGAGTGTGAGAAGCATTCCCAACCCTGGCAGGTG
GCTGTGTACAGTCATGGATGGGCACACTGTGGGGGTGTCCTGGTGCACCCCCAGTGGGTG
CTCACAGCTGCCCATTGCCTAAAGAAGAATAGCCAGGTCTGGCTGGGTCGGCACAACCTG
TTTGAGCCTGAAGACACAGGCCAGAGGGTCCCTGTCAGCCACAGCTTCCCACACCCGCTC
TACAATATGAGCCTTCTGAAGCATCAAAGCCTTAGACCAGATGAAGACTCCAGCCATGAC
CTCATGCTGCTCCGCCTGTCAGAGCCTGCCAAGATCACAGATGTTGTGAAGGTCCTGGGC
CTGCCCACCCAGGAGCCAGCACTGGGGACCACCTGCTACGCCTCAGGCTGGGGCAGCATC
GAACCAGAGGAGTTCTTGCGCCCCAGGAGTCTTCAGTGTGTGAGCCTCCATCTCCTGTCC
AATGACATGTGTGCTAGAGCTTACTCTGAGAAGGTGACAGAGTTCATGTTGTGTGCTGGG
CTCTGGACAGGTGGTAAAGACACTTGTGGGGTGAGTCATCCCTACTCCCAACATCTGGAG
GGGAAAGGGTGA
Restriction Sites Please inquire     
ACCN NM_001002231
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001002231.1, NP_001002231.1
RefSeq Size 2892 bp
RefSeq ORF 672 bp
Locus ID 3817
Cytogenetics 19q13.33
Protein Families Druggable Genome, Protease
Gene Summary 'This gene encodes a member of the grandular kallikrein protein family. Kallikreins are a subgroup of serine proteases that are clustered on chromosome 19. Members of this family are involved in a diverse array of biological functions. The protein encoded by this gene is a highly active trypsin-like serine protease that selectively cleaves at arginine residues. This protein is primarily expressed in prostatic tissue and is responsible for cleaving pro-prostate-specific antigen into its enzymatically active form. This gene is highly expressed in prostate tumor cells and may be a prognostic maker for prostate cancer risk. Alternate splicing results in both coding and non-coding transcript variants. [provided by RefSeq, Jan 2012]'
Transcript Variant: This variant (2) uses an alternate splice site in the 3' coding region, which results in a frameshift, compared to variant 1. It encodes isoform 2, which has a shorter and distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.