Apc11 (ANAPC11) (NM_001002245) Human Untagged Clone
CAT#: SC300412
ANAPC11 (untagged)-Human anaphase promoting complex subunit 11 (ANAPC11), transcript variant 3
"NM_001002245" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | ANAPC11 |
Synonyms | APC11; Apc11p; HSPC214 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001002245, the custom clone sequence may differ by one or more nucleotides
ATGAAGGTGAAGATTAAGTGCTGGAACGGCGTGGCCACTTGGCTCTGGGTGGCCAACGATGAGAACTGTG GCATCTGCAGGATGGCATTTAACGGATGCTGCCCTGACTGCAAGGTGCCCGGCGACGACTGCCCGCTGGT GTGGGGCCAGTGCTCCCACTGCTTCCACATGCATTGCATCCTCAAGTGGCTGCACGCACAGCAGGTGCAG CAGCACTGCCCCATGTGCCGCCAGGAATGGAAGTTCAAGGAGTGA |
Chromatograms |
CHROMATOGRAMS
Sequencher program is needed, download here. |
Restriction Sites | Please inquire |
ACCN | NM_001002245 |
ORF Size | 255 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001002245.1, NP_001002245.1 |
RefSeq Size | 799 |
RefSeq ORF | 255 |
Locus ID | 51529 |
Protein Families | Druggable Genome |
Protein Pathways | Cell cycle, Oocyte meiosis, Progesterone-mediated oocyte maturation, Ubiquitin mediated proteolysis |
Gene Summary | Together with the cullin protein ANAPC2, constitutes the catalytic component of the anaphase promoting complex/cyclosome (APC/C), a cell cycle-regulated E3 ubiquitin ligase that controls progression through mitosis and the G1 phase of the cell cycle. The APC/C complex acts by mediating ubiquitination and subsequent degradation of target proteins: it mainly mediates the formation of 'Lys-11'-linked polyubiquitin chains and, to a lower extent, the formation of 'Lys-48'- and 'Lys-63'-linked polyubiquitin chains. May recruit the E2 ubiquitin-conjugating enzymes to the complex. [UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (3) uses an alternate splice site in the 5' UTR and lacks an exon in the 3' coding region, which results in a frameshift, compared to variant 1. The encoded isoform (2) has a distinct C-terminus and is shorter than isoform 1. Variants 2, 3, 4, 5, 6, 7, 8, 9, 10, and 11 encode the isoform 2. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC223841 | ANAPC11 (Myc-DDK-tagged)-Human anaphase promoting complex subunit 11 (ANAPC11), transcript variant 3 |
USD 420.00 |
|
RG223841 | ANAPC11 (GFP-tagged) - Human anaphase promoting complex subunit 11 (ANAPC11), transcript variant 3 |
USD 460.00 |
|
RC223841L3 | Lenti-ORF clone of ANAPC11 (Myc-DDK-tagged)-Human anaphase promoting complex subunit 11 (ANAPC11), transcript variant 3 |
USD 620.00 |
|
RC223841L4 | Lenti-ORF clone of ANAPC11 (mGFP-tagged)-Human anaphase promoting complex subunit 11 (ANAPC11), transcript variant 3 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review