Apc11 (ANAPC11) (NM_001002248) Human Untagged Clone

CAT#: SC300415

ANAPC11 (untagged)-Human anaphase promoting complex subunit 11 (ANAPC11), transcript variant 6


  "NM_001002248" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "ANAPC11"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ANAPC11
Synonyms APC11; Apc11p; HSPC214
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001002248, the custom clone sequence may differ by one or more nucleotides
ATGAAGGTGAAGATTAAGTGCTGGAACGGCGTGGCCACTTGGCTCTGGGTGGCCAACGAT
GAGAACTGTGGCATCTGCAGGATGGCATTTAACGGATGCTGCCCTGACTGCAAGGTGCCC
GGCGACGACTGCCCGCTGGTGTGGGGCCAGTGCTCCCACTGCTTCCACATGCATTGCATC
CTCAAGTGGCTGCACGCACAGCAGGTGCAGCAGCACTGCCCCATGTGCCGCCAGGAATGG
AAGTTCAAGGAGTGA
Restriction Sites Please inquire     
ACCN NM_001002248
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001002248.1, NP_001002248.1
RefSeq Size 870 bp
RefSeq ORF 255 bp
Locus ID 51529
Cytogenetics 17q25.3
Protein Families Druggable Genome
Protein Pathways Cell cycle, Oocyte meiosis, Progesterone-mediated oocyte maturation, Ubiquitin mediated proteolysis
Gene Summary Together with the cullin protein ANAPC2, constitutes the catalytic component of the anaphase promoting complex/cyclosome (APC/C), a cell cycle-regulated E3 ubiquitin ligase that controls progression through mitosis and the G1 phase of the cell cycle. The APC/C complex acts by mediating ubiquitination and subsequent degradation of target proteins: it mainly mediates the formation of 'Lys-11'-linked polyubiquitin chains and, to a lower extent, the formation of 'Lys-48'- and 'Lys-63'-linked polyubiquitin chains. May recruit the E2 ubiquitin-conjugating enzymes to the complex. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (6) uses an alternate splice site and contains an alternate exon in the 5' UTR and lacks an exon in the 3' coding region, which results in a frameshift, compared to variant 1. The encoded isoform (2) has a distinct C-terminus and is shorter than isoform 1. Variants 2, 3, 4, 5, 6, 7, 8, 9, 10, and 11 encode the isoform 2.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.