CENPM (NM_001002876) Human Untagged Clone

CAT#: SC300469

CENPM (untagged)-Human centromere protein M (CENPM), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CENPM
• Synonyms: C22orf18; CENP-M; PANE1
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001002876, the custom clone sequence may differ by one or more nucleotides
  ATGTCGGTGTTGAGGCCCCTGGACAAGCTGCCCGGCCTGAACACGGCCACCATCTTGCTG
  GTGGGCACGGAGGATGCTCTTCTGCAGCAGCTGGCGGACTCGATGCTCAAAGAGGACTGC
  GCCTCCGAGCTGAAGGTCCACTTGGCAAAGTCCCTCCCTTTGCCCTCCAGTGTGAATCGG
  CCCCGAATTGACCTGATCGTGTTTGTGGTTAATCTTCACAGCAAATACAGTCTCCAGAAC
  ACAGAGGAGTCCCTGCGCCATGTGGATGCCAGCTTCTTCTTGGGGAAGGTGTGTTTCCTC
  GCCACAGGTGGTGGAAGGCTTTAG
  
• Restriction Sites: Please inquire
• ACCN: NM_001002876
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001002876.1, NP_001002876.1
• RefSeq Size: 855 bp
• RefSeq ORF: 324 bp
• Locus ID: 79019
• Cytogenetics: 22q13.2
• Protein Families: Druggable Genome
• Gene Summary: The protein encoded by this gene is an inner protein of the kinetochore, the multi-protein complex that binds spindle microtubules to regulate chromosome segregation during cell division. It belongs to the constitutive centromere-associated network protein group, whose members interact with outer kinetochore proteins and help to maintain centromere identity at each cell division cycle. The protein is structurally related to GTPases but cannot bind guanosine triphosphate. A point mutation that affects interaction with another constitutive centromere-associated network protein, CENP-I, impairs kinetochore assembly and chromosome alignment, suggesting that it is required for kinetochore formation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
  Transcript Variant: This variant (2) lacks an alternate coding exon compared to variant 1, which causes a frameshift. The resulting isoform (b) is shorter and has a distinct C-terminus compared to isoform a.