H2BW1 (NM_001002916) Human Untagged Clone

CAT#: SC300484

H2BFWT (untagged)-Human H2B histone family, member W, testis-specific (H2BFWT)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: H2BW1
• Synonyms: H2BFWT
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001002916, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCTGCGTACCGAAGTGCCCCGGCTTCCCCGGTCCACAACCGCCATTGTCTGGTCGTGCCATCTAATGG
  CCACTGCCTCCGCCATGGCTGGACCTTCCTCTGAGACGACCTCTGAGGAACAGCTGATCACCCAGGAGCC
  CAAAGAGGCCAACTCCACTACGTCCCAGAAGCAGAGCAAGCAGAGGAAGCGAGGGCGCCATGGGCCCCGC
  AGGTGCCACTCCAACTGCCGCGGGGACAGCTTCGCCACCTATTTCCGCCGGGTGCTGAAGCAGGTTCACC
  AGGGCCTCAGCCTTTCCCGGGAGGCCGTGAGTGTCATGGATTCTTTGGTTCATGACATATTGGACCGCAT
  CGCCACCGAGGCTGGTCACCTGGCCCGCTCCACCAAGCGCCAGACCATCACTGCCTGGGAGACCCGGATG
  GCTGTGCGCCTGCTGCTGCCGGGGCAGATGGGCAAGCTCGCCGAGTCCGAAGGCACGAAGGCTGTCCTCA
  GAACTTCACTGTATGCCATACAGCAACAGAGAAAGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001002916
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001002916.4, NP_001002916.3
• RefSeq Size: 922 bp
• RefSeq ORF: 528 bp
• Locus ID: 158983
• Cytogenetics: Xq22.2
• Protein Pathways: Systemic lupus erythematosus
• Gene Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene encodes a replication-independent histone that is a member of the H2B histone family that is specifically expressed in sperm nuclei. A polymorphism in the 5' UTR of this gene is associated with male infertility. [provided by RefSeq, Oct 2015]