ATP5PD (NM_001003785) Human Untagged Clone

CAT#: SC300539

ATP5H (untagged)-Human ATP synthase, H+ transporting, mitochondrial Fo complex, subunit d (ATP5H), nuclear gene encoding mitochondrial protein, transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ATP5PD
• Synonyms: APT5H; ATP5H; ATPQ
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001003785, the custom clone sequence may differ by one or more nucleotides
  ATGGCTGGGCGAAAACTTGCTCTAAAAACCATTGACTGGGTAGCTTTTGCAGAGATCATA
  CCCCAGAACCAAAAGGCCATTGCTAGTTCCCTGAAATCCTGGAATGAGACCCTCACCTCC
  AGGTTGGCTGCTTTACCTGAGAATCCACCAGCTATCGACTGGGCTTACTACAAGGCCAAT
  GTGGCCAAGGCTGGCTTGGTGGATGACTTTGAGAAGAAGGTGAAATCTTGTGCTGAGTGG
  GTGTCTCTCTCAAAGGCCAGGATTGTAGAATATGAGAAAGAGATGGAGAAGATGAAGAAC
  TTAATTCCATTTGATCAGATGACCATTGAGGACTTGAATGAAGCTTTCCCAGAAACCAAA
  TTAGACAAGAAAAAGTATCCCTATTGGCCTCACCAACCAATTGAGAATTTATAA
  
• Restriction Sites: Please inquire
• ACCN: NM_001003785
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001003785.1, NP_001003785.1
• RefSeq Size: 556 bp
• RefSeq ORF: 414 bp
• Locus ID: 10476
• Cytogenetics: 17q25.1
• Protein Pathways: Alzheimer's disease, Huntington's disease, Metabolic pathways, Oxidative phosphorylation, Parkinson's disease
• Gene Summary: Mitochondrial ATP synthase catalyzes ATP synthesis, utilizing an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. It is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, which comprises the proton channel. The F1 complex consists of 5 different subunits (alpha, beta, gamma, delta, and epsilon) assembled in a ratio of 3 alpha, 3 beta, and a single representative of the other 3. The Fo seems to have nine subunits (a, b, c, d, e, f, g, F6 and 8). This gene encodes the d subunit of the Fo complex. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. In addition, three pseudogenes are located on chromosomes 9, 12 and 15. [provided by RefSeq, Jun 2010]
  Transcript Variant: This variant (2) lacks an in-frame segment of the coding region, compared to variant 1. It encodes a shorter isoform (b), that is missing an internal segment compared to isoform a.