TXNDC8 (NM_001003936) Human Untagged Clone

CAT#: SC300577

TXNDC8 (untagged)-Human thioredoxin domain containing 8 (spermatozoa) (TXNDC8)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TXNDC8
• Synonyms: bA427L11.2; SPTRX-3; SPTRX3; TRX6
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001003936, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGTACAGATTATTAAAGACACGAATGAATTTAAAACATTTTTGACAGCTGCCGGACACAAACTCGCAG
  TGGTTCAATTTTCTTCGAAACGGTGTGGTCCCTGCAAAAGGATGTTTCCTGTTTTCCATGCTATGTCTGT
  GAAATACCAAAATGTATTTTTTGCTAATGTGGATGTGAACAATTCTCCGGAGCTGGCTGAAACTTGTCAC
  ATCAAAACAATACCCACATTTCAGATGTTCAAGAAAAGCCAGAAGGTAACCCTATTCTCAAGAATCAAAA
  GAATAATTTGCTGTTATAGAAGTGGATTCATGAGCAACCTGTGTCTTGCAGATGATGGAAATGAGTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001003936
• ORF Size: 348 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001003936.3, NP_001003936.1
• RefSeq Size: 540
• RefSeq ORF: 348
• Locus ID: 255220
• Protein Families: Druggable Genome
• Gene Summary: May be required for post-translational modifications of proteins required for acrosomal biogenesis. May act by reducing disulfide bonds within the sperm. [UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (1) encodes the longest isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. COMPLETENESS: complete on the 3' end.