OGDH (NM_001003941) Human Untagged Clone

CAT#: SC300581

OGDH (untagged)-Human oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide) (OGDH), nuclear gene encoding mitochondrial protein, transcript variant 2


  "NM_001003941" in other vectors (6)

Reconstitution Protocol

USD 720.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "OGDH"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol OGDH
Synonyms AKGDH; E1k; KGD1; OGDC; OGDH2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001003941, the custom clone sequence may differ by one or more nucleotides


ATGTTTCATTTAAGGACTTGTGCTGCTAAGTTGAGGCCATTGACGGCTTCCCAGACTGTTAAGACATTTT
CACAAAACAGACCAGCAGCAGCTAGGACATTTCAACAGATTCGGTGCTATTCTGCACCTGTTGCTGCTGA
GCCCTTTCTCAGTGGGACTAGTTCGAACTATGTGGAGGAGATGTACTGTGCTTGGCTGGAAAACCCCAAA
AGTGTACATAAGTCATGGGACATTTTTTTTCGCAACACGAATGCCGGAGCCCCACCGGGCACTGCCTACC
AGAGTCCCCTTCCCCTGAGCCGAGGCTCCCTGGCTGCTGTGGCCCATGCACAGTCCCTGGTAGAAGCACA
GCCCAACGTGGACAAGCTCGTGGAGGACCACCTGGCAGTGCAGTCGCTCATCAGGGCATATCAGATACGA
GGGCACCATGTAGCACAGCTGGACCCCCTGGGGATTTTGGATGCTGATCTGGACTCCTCCGTGCCCGCTG
ACATTATCTCATCCACAGACAAACTTGGGTTCTATGGCCTGGATGAGTCTGACCTCGACAAGGTCTTCCA
CTTGCCCACCACCACTTTCATCGGGGGACAGGAATCAGCACTTCCTCTGCGGGAGATCATCCGTCGGCTG
GAGATGGCCTACTGCCAGCATATTGGGGTGGAGTTCATGTTCATCAATGACCTGGAGCAGTGCCAGTGGA
TCCGGCAGAAGTTTGAGACCCCTGGGATCATGCAGTTCACAAATGAGGAGAAACGGACCCTGCTGGCCAG
GCTTGTGCGGTCCACCAGGTTTGAGGAGTTCCTACAGCGGAAGTGGTCCTCTGAGAAGCGCTTTGGTCTA
GAAGGCTGCGAGGTACTGATCCCTGCCCTCAAGACCATCATTGACAAGTCTAGTGAGAATGGCGTGGACT
ACGTGATCATGGGCATGCCACACAGAGGGCGGCTGAACGTGCTTGCAAATGTCATCAGGAAGGAGCTGGA
ACAGATCTTCTGTCAATTCGATTCAAAGCTGGAGGCAGCTGATGAGGGCTCCGGAGATGTGAAGTACCAC
CTGGGCATGTATCACCGCAGGATCAATCGTGTCACCGACAGGAACATTACCTTGTCCTTGGTGGCCAACC
CTTCCCACCTTGAGGCCGCTGACCCCGTGGTGATGGGCAAGACCAAAGCCGAACAGTTTTACTGTGGCGA
CACTGAAGGGAAAAAGGTAAGGCCCAGAGAGAGGCGTGCAAGGCAGATCGTCAAGGCCCCATGTTCCAGC
ATGGAGTTCCGCTCACCAACATAA


Restriction Sites SgfI-MluI     
ACCN NM_001003941
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001003941.2, NP_001003941.1
RefSeq Size 1829 bp
RefSeq ORF 1284 bp
Locus ID 4967
Cytogenetics 7p13
Protein Families Druggable Genome
Protein Pathways Citrate cycle (TCA cycle), Lysine degradation, Metabolic pathways, Tryptophan metabolism
Gene Summary 'This gene encodes one subunit of the 2-oxoglutarate dehydrogenase complex. This complex catalyzes the overall conversion of 2-oxoglutarate (alpha-ketoglutarate) to succinyl-CoA and CO(2) during the Krebs cycle. The protein is located in the mitochondrial matrix and uses thiamine pyrophosphate as a cofactor. A congenital deficiency in 2-oxoglutarate dehydrogenase activity is believed to lead to hypotonia, metabolic acidosis, and hyperlactatemia. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Sep 2009]'
Transcript Variant: This variant (2) uses an alternate splice site in the 3' end of coding region, compared to variant 1. Variant 2 encodes isoform 2 which has a shorter and distinct C-terminus, compared to isoform 1. Variant 2 is supported by transcriptional evidence although the protein product is predicted.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.