OR10G2 (NM_001005466) Human Untagged Clone

CAT#: SC300955

OR10G2 (untagged)-Human olfactory receptor, family 10, subfamily G, member 2 (OR10G2)


  "NM_001005466" in other vectors (4)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "OR10G2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol OR10G2
Synonyms OR14-41
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001005466, the custom clone sequence may differ by one or more nucleotides


ATGGGAAAGACCAAAAACACATCGCTGGATGCCGTGGTGACAGATTTCATTCTTCTGGGTTTGTCTCACC
CCCCAAATCTAAGAAGCCTCCTCTTCCTGGTCTTCTTCATCATTTACATCCTCACTCAGCTGGGGAACCT
GCTCATTCTGCTCACCATGTGGGCTGACCCGAAGCTCTGTGCTCGCCCCATGTACATTCTTCTGGGAGTG
CTCTCATTCCTGGACATGTGGCTCTCCTCAGTCACCGTTCCTCTGCTTATTTTGGATTTTACTCCTTCCA
TCAAGGCTATCCCGTTTGGTGGCTGTGTGGCTCAACTGTATTTCTTTCACTTCCTGGGCAGCACCCAGTG
CTTCCTCTACACCTTGATGGCCTATGACAGGTACCTGGCAATATGTCAGCCCCTGCGCTACCCAGTGCTC
ATGAATGGGAGGTTATGCACAGTCCTTGTGGCTGGAGCTTGGGTCGCCGGCTCCATGCATGGGTCTATCC
AGGCCACCTTGACCTTCCGCCTGCCCTACTGTGGGCCCAATCAGGTGGATTACTTTATCTGTGACATCCC
CGCAGTATTGAGACTGGCCTGTGCTGACACAACTGTCAATGAGCTTGTGACCTTTGTGGACGTCGGGGTA
GTGGCCGCCAGTTGCTTCATGTTAATTCTGCTCTCGTATGCCAACATAGTAAATGCCATCCTGAAGATAC
GCACCACTGATGGGAGGCGCCGGGCCTTCTCCACCTGTGGCTCCCACCTAATCGTGGTCACAGTCTACTA
TGTCCCCTGTATTTTCATCTACCTTAGGGCTGGCTCCAAAGACCCCCTGGATGGGGCAGCGGCTGTGTTT
TACACTGTTGTCACTCCATTACTGAACCCCCTCATCTATACACTGAGGAACCAGGAAGTGAAGTCTGCCC
TGAAGAGGATAACAGCAGGTTGA


Restriction Sites SgfI-MluI     
ACCN NM_001005466
ORF Size 933 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001005466.2, NP_001005466.2
RefSeq Size 1105
RefSeq ORF 933
Locus ID 26534
Protein Families Transmembrane
Protein Pathways Olfactory transduction
Gene Summary Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.