CACNB4 (NM_001005746) Human Untagged Clone

CAT#: SC301025

CACNB4 (untagged)-Human calcium channel, voltage-dependent, beta 4 subunit (CACNB4), transcript variant 3


  "NM_001005746" in other vectors (4)

Reconstitution Protocol

USD 840.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "CACNB4"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CACNB4
Synonyms CAB4; CACNLB4; EA5; EIG9; EJM; EJM4; EJM6
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001005746, the custom clone sequence may differ by one or more nucleotides


ATGGATGTGGTGGCCCGAGGCACCACAACCCGGAGGAGCAGGTTGAAAAGATCCGATGGCAGCACCACTT
CGACCAGCTTCATCCTCAGACAGGGTTCAGCGGATTCCTACACAAGCAGGCCGTCTGACTCCGATGTCTC
TTTGGAAGAGGACCGGGAAGCAATTCGACAGGAGAGAGAACAGCAAGCAGCTATCCAGCTTGAGAGAGCA
AAGTCCAAACCTGTAGCATTTGCCGTGAAGACAAATGTGAGCTACTGCGGCGCCCTGGACGAGGATGTGC
CTGTTCCAAGCACAGCTATCTCCTTTGATGCTAAAGACTTTCTACATATTAAAGAGAAATATAACAATGA
TTGGTGGATAGGAAGGCTGGTGAAAGAGGGCTGTGAAATTGGCTTCATTCCAAGTCCACTCAGATTGGAG
AACATACGGATCCAGCAAGAACAAAAAAGAGGACGTTTTCACGGAGGGAAATCAAGTGGAAATTCTTCTT
CAAGTCTTGGAGAAATGGTATCTGGGACATTCCGAGCAACTCCCACATCAACAGCAAAACAGAAGCAAAA
AGTGACGGAGCACATTCCTCCTTACGATGTTGTACCGTCAATGCGTCCGGTGGTGTTAGTGGGGCCGTCA
CTGAAAGGTTACGAGGTAACAGACATGATGCAGAAAGCCCTCTTTGATTTCCTGAAGCACAGGTTTGATG
GGAGGATTTCAATAACGAGAGTGACAGCTGACATTTCTCTTGCTAAGAGGTCTGTCCTAAATAATCCCAG
CAAGAGAGCAATAATTGAACGTTCGAACACCCGGTCCAGCTTAGCGGAAGTACAAAGTGAAATTGAAAGA
ATCTTTGAGTTGGCAAGATCTTTGCAACTGGTTGTTCTTGATGCAGACACCATCAATCACCCAGCACAAC
TTATAAAGACTTCCTTAGCACCAATTATTGTTCATGTAAAAGTCTCATCTCCAAAGGTTTTACAGCGGTT
GATTAAATCTAGAGGAAAGTCACAAAGTAAACACTTGAATGTTCAACTGGTGGCAGCTGATAAACTTGCA
CAATGCCCCCCAGAAATGTTTGATGTTATATTGGATGAAAATCAGCTTGAGGATGCATGTGAACATCTAG
GGGAGTACCTGGAGGCGTACTGGCGTGCCACCCACACAACCAGTAGCACACCCATGACCCCGCTGCTGGG
AAGGAATTTGGGCTCCACGGCACTCTCACCATATCCCACAGCAATTTCTGGGTTACAGAGTCAGCGAATG
AGGCACAGCAACCACTCCACAGAGAACTCTCCAATTGAAAGACGAAGTCTAATGACCTCTGATGAAAATT
ATCACAATGAAAGGGCTCGGAAGAGTAGGAACCGCTTGTCTTCCAGTTCTCAGCATAGCCGAGATCATTA
CCCTCTTGTGGAAGAAGATTACCCTGACTCATACCAGGACACTTACAAACCCCATAGGAACCGAGGATCA
CCTGGGGGATATAGCCATGACTCCCGACATAGGCTTTGA


Restriction Sites SgfI-MluI     
ACCN NM_001005746
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001005746.2, NP_001005746.1
RefSeq Size 7929 bp
RefSeq ORF 1509 bp
Locus ID 785
Cytogenetics 2q23.3
Protein Families Druggable Genome, Ion Channels: Other
Protein Pathways Arrhythmogenic right ventricular cardiomyopathy (ARVC), Cardiac muscle contraction, Dilated cardiomyopathy, Hypertrophic cardiomyopathy (HCM), MAPK signaling pathway
Gene Summary 'This gene encodes a member of the beta subunit family of voltage-dependent calcium channel complex proteins. Calcium channels mediate the influx of calcium ions into the cell upon membrane polarization and consist of a complex of alpha-1, alpha-2/delta, beta, and gamma subunits in a 1:1:1:1 ratio. Various versions of each of these subunits exist, either expressed from similar genes or the result of alternative splicing. The protein encoded by this locus plays an important role in calcium channel function by modulating G protein inhibition, increasing peak calcium current, controlling the alpha-1 subunit membrane targeting and shifting the voltage dependence of activation and inactivation. Certain mutations in this gene have been associated with idiopathic generalized epilepsy (IGE), juvenile myoclonic epilepsy (JME), and episodic ataxia, type 5. [provided by RefSeq, Aug 2016]'
Transcript Variant: This variant (3) differs in the 5' UTR and 5' coding region, compared to variant 2. The resulting isoform (c) has a shorter and distinct N-terminus, compared to isoform b. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.