Inositol Hexakisphosphate Kinase 2 (IP6K2) (NM_001005911) Human Untagged Clone
CAT#: SC301048
IP6K2 (untagged)-Human inositol hexakisphosphate kinase 2 (IP6K2), transcript variant 4
"NM_001005911" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | IP6K2 |
Synonyms | IHPK2; InsP6K2; PIUS |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001005911, the custom clone sequence may differ by one or more nucleotides
ATGAGCCCAGCCTTCAGGGCCATGGATGTGGAGCCCCGCGCCAAAGGCGTCCTTCTGGAG CCCTTTGTCCACCAGGTCGGGGGGCACTCATGCGTGCTCCGCTTCAATGAGACAACCCTG TGCAAGCCCCTGGTCCCAAGGGAACATCAGTTCTACGAGACCCTCCCTGCTGAGATGCGC AAATTCACTCCCCAGTACAAAGGACAAAGCCAAAGGCCCCTTGTTAGCTGGCCATCCCTG CCCCATTTTTTCCCCTGGTCCTTTCCCCTGTGGCCACAGGGAAGTGTGGCCTGA |
Restriction Sites | Please inquire |
ACCN | NM_001005911 |
ORF Size | 1254 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001005911.1, NP_001005911.1 |
RefSeq Size | 1254 |
RefSeq ORF | 1254 |
Locus ID | 51447 |
Protein Families | Druggable Genome |
Gene Summary | This gene encodes a protein that belongs to the inositol phosphokinase (IPK) family. This protein is likely responsible for the conversion of inositol hexakisphosphate (InsP6) to diphosphoinositol pentakisphosphate (InsP7/PP-InsP5). It may also convert 1,3,4,5,6-pentakisphosphate (InsP5) to PP-InsP4 and affect the growth suppressive and apoptotic activities of interferon-beta in some ovarian cancers. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (4) uses an alternate in-frame splice site in the 5' UTR and differs in the 3' coding region and 3' UTR, compared to variant 1. The resulting isoform (b) has a distinct C-terminus and is shorter than isoform a. Variants 3 and 4 encode the same isoform (b). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC223857 | IP6K2 (Myc-DDK-tagged)-Human inositol hexakisphosphate kinase 2 (IP6K2), transcript variant 4 |
USD 420.00 |
|
RG223857 | IP6K2 (GFP-tagged) - Human inositol hexakisphosphate kinase 2 (IP6K2), transcript variant 4 |
USD 460.00 |
|
RC223857L3 | Lenti-ORF clone of IP6K2 (Myc-DDK-tagged)-Human inositol hexakisphosphate kinase 2 (IP6K2), transcript variant 4 |
USD 620.00 |
|
RC223857L4 | Lenti-ORF clone of IP6K2 (mGFP-tagged)-Human inositol hexakisphosphate kinase 2 (IP6K2), transcript variant 4 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review