SIAH1 (NM_001006610) Human Untagged Clone

CAT#: SC301071

SIAH1 (untagged)-Human seven in absentia homolog 1 (Drosophila) (SIAH1), transcript variant 2


  "NM_001006610" in other vectors (6)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "SIAH1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SIAH1
Synonyms SIAH1A
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001006610, the custom clone sequence may differ by one or more nucleotides


ATGACGGGAAAGGCTACTCCACCTTCTCTGTACTCCTGGAGGGGAGTCTTGTTCACATGTTTACCAGCGG
CCAGGACAAGGAAGAGAAAAGAAATGAGCCGTCAGACTGCTACAGCATTACCTACCGGTACCTCGAAGTG
TCCACCATCCCAGAGGGTGCCTGCCCTGACTGGCACAACTGCATCCAACAATGACTTGGCGAGTCTTTTT
GAGTGTCCAGTCTGCTTTGACTATGTGTTACCGCCCATTCTTCAATGTCAGAGTGGCCATCTTGTTTGTA
GCAACTGTCGCCCAAAGCTCACATGTTGTCCAACTTGCCGGGGCCCTTTGGGATCCATTCGCAACTTGGC
TATGGAGAAAGTGGCTAATTCAGTACTTTTCCCCTGTAAATATGCGTCTTCTGGATGTGAAATAACTCTG
CCACACACAGAAAAAGCAGACCATGAAGAGCTCTGTGAGTTTAGGCCTTATTCCTGTCCGTGCCCTGGTG
CTTCCTGTAAATGGCAAGGCTCTCTGGATGCTGTAATGCCCCATCTGATGCATCAGCATAAGTCCATTAC
AACCCTACAGGGAGAGGATATAGTTTTTCTTGCTACAGACATTAATCTTCCTGGTGCTGTTGACTGGGTG
ATGATGCAGTCCTGTTTTGGCTTTCACTTCATGTTAGTCTTAGAGAAACAGGAAAAATACGATGGTCACC
AGCAGTTCTTCGCAATCGTACAGCTGATAGGAACACGCAAGCAAGCTGAAAATTTTGCTTACCGACTTGA
GCTAAATGGTCATAGGCGACGATTGACTTGGGAAGCGACTCCTCGATCTATTCATGAAGGAATTGCAACA
GCCATTATGAATAGCGACTGTCTAGTCTTTGACACCAGCATTGCACAGCTTTTTGCAGAAAATGGCAATT
TAGGCATCAATGTAACTATTTCCATGTGTTGA


Restriction Sites SgfI-MluI     
ACCN NM_001006610
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001006610.1, NP_001006611.1
RefSeq Size 2393 bp
RefSeq ORF 942 bp
Locus ID 6477
Cytogenetics 16q12.1
Protein Families Druggable Genome
Protein Pathways p53 signaling pathway, Ubiquitin mediated proteolysis, Wnt signaling pathway
Gene Summary 'This gene encodes a protein that is a member of the seven in absentia homolog (SIAH) family. The protein is an E3 ligase and is involved in ubiquitination and proteasome-mediated degradation of specific proteins. The activity of this ubiquitin ligase has been implicated in the development of certain forms of Parkinson's disease, the regulation of the cellular response to hypoxia and induction of apoptosis. Alternative splicing results in several additional transcript variants, some encoding different isoforms and others that have not been fully characterized. [provided by RefSeq, Jul 2008]'
Transcript Variant: This variant (2) includes an alternate 5' exon and uses an upstream AUG compared to variant 1. The resulting protein (isoform b) is longer and has a distinct N-terminus compared to isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.