SIAH1 (NM_001006610) Human Untagged Clone
CAT#: SC301071
SIAH1 (untagged)-Human seven in absentia homolog 1 (Drosophila) (SIAH1), transcript variant 2
"NM_001006610" in other vectors (6)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | SIAH1 |
Synonyms | SIAH1A |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001006610, the custom clone sequence may differ by one or more nucleotides
ATGACGGGAAAGGCTACTCCACCTTCTCTGTACTCCTGGAGGGGAGTCTTGTTCACATGTTTACCAGCGG CCAGGACAAGGAAGAGAAAAGAAATGAGCCGTCAGACTGCTACAGCATTACCTACCGGTACCTCGAAGTG TCCACCATCCCAGAGGGTGCCTGCCCTGACTGGCACAACTGCATCCAACAATGACTTGGCGAGTCTTTTT GAGTGTCCAGTCTGCTTTGACTATGTGTTACCGCCCATTCTTCAATGTCAGAGTGGCCATCTTGTTTGTA GCAACTGTCGCCCAAAGCTCACATGTTGTCCAACTTGCCGGGGCCCTTTGGGATCCATTCGCAACTTGGC TATGGAGAAAGTGGCTAATTCAGTACTTTTCCCCTGTAAATATGCGTCTTCTGGATGTGAAATAACTCTG CCACACACAGAAAAAGCAGACCATGAAGAGCTCTGTGAGTTTAGGCCTTATTCCTGTCCGTGCCCTGGTG CTTCCTGTAAATGGCAAGGCTCTCTGGATGCTGTAATGCCCCATCTGATGCATCAGCATAAGTCCATTAC AACCCTACAGGGAGAGGATATAGTTTTTCTTGCTACAGACATTAATCTTCCTGGTGCTGTTGACTGGGTG ATGATGCAGTCCTGTTTTGGCTTTCACTTCATGTTAGTCTTAGAGAAACAGGAAAAATACGATGGTCACC AGCAGTTCTTCGCAATCGTACAGCTGATAGGAACACGCAAGCAAGCTGAAAATTTTGCTTACCGACTTGA GCTAAATGGTCATAGGCGACGATTGACTTGGGAAGCGACTCCTCGATCTATTCATGAAGGAATTGCAACA GCCATTATGAATAGCGACTGTCTAGTCTTTGACACCAGCATTGCACAGCTTTTTGCAGAAAATGGCAATT TAGGCATCAATGTAACTATTTCCATGTGTTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001006610 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001006610.1, NP_001006611.1 |
RefSeq Size | 2393 bp |
RefSeq ORF | 942 bp |
Locus ID | 6477 |
Cytogenetics | 16q12.1 |
Protein Families | Druggable Genome |
Protein Pathways | p53 signaling pathway, Ubiquitin mediated proteolysis, Wnt signaling pathway |
Gene Summary | 'This gene encodes a protein that is a member of the seven in absentia homolog (SIAH) family. The protein is an E3 ligase and is involved in ubiquitination and proteasome-mediated degradation of specific proteins. The activity of this ubiquitin ligase has been implicated in the development of certain forms of Parkinson's disease, the regulation of the cellular response to hypoxia and induction of apoptosis. Alternative splicing results in several additional transcript variants, some encoding different isoforms and others that have not been fully characterized. [provided by RefSeq, Jul 2008]' Transcript Variant: This variant (2) includes an alternate 5' exon and uses an upstream AUG compared to variant 1. The resulting protein (isoform b) is longer and has a distinct N-terminus compared to isoform a. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC211475 | SIAH1 (Myc-DDK-tagged)-Human seven in absentia homolog 1 (Drosophila) (SIAH1), transcript variant 2 |
USD 420.00 |
|
RG211475 | SIAH1 (GFP-tagged) - Human seven in absentia homolog 1 (Drosophila) (SIAH1), transcript variant 2 |
USD 460.00 |
|
RC211475L1 | Lenti ORF clone of Human seven in absentia homolog 1 (Drosophila) (SIAH1), transcript variant 2, Myc-DDK-tagged |
USD 768.00 |
|
RC211475L2 | Lenti ORF clone of Human seven in absentia homolog 1 (Drosophila) (SIAH1), transcript variant 2, mGFP tagged |
USD 620.00 |
|
RC211475L3 | Lenti ORF clone of Human seven in absentia homolog 1 (Drosophila) (SIAH1), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC211475L4 | Lenti ORF clone of Human seven in absentia homolog 1 (Drosophila) (SIAH1), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review