WBP5 (TCEAL9) (NM_001006612) Human Untagged Clone
CAT#: SC301073
WBP5 (untagged)-Human WW domain binding protein 5 (WBP5), transcript variant 2
"NM_001006612" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | TCEAL9 |
Synonyms | WBP5; WEX6 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001006612, the custom clone sequence may differ by one or more nucleotides
ATGAAATCCTGTCAAAAAATGGAAGGAAAACCAGAAAATGAGAGTGAACCAAAGCATGAGGAAGAGCCAA AGCCTGAGGAAAAGCCAGAAGAGGAGGAGAAGCTAGAGGAGGAGGCCAAAGCAAAAGGAACTTTTAGAGA AAGGCTGATTCAATCTCTCCAGGAGTTTAAAGAAGATATACACAACAGGCATTTAAGCAATGAAGATATG TTTAGAGAAGTGGATGAAATAGATGAGATAAGGAGAGTCAGAAACAAACTTATAGTGATGCGTTGGAAGG TTAATCGAAACCATCCTTACCCCTATTTAATGTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001006612 |
ORF Size | 315 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001006612.1, NP_001006613.1 |
RefSeq Size | 1099 |
RefSeq ORF | 315 |
Locus ID | 51186 |
Gene Summary | The globular WW domain is composed of 38 to 40 semiconserved amino acids shared by proteins of diverse functions including structural, regulatory, and signaling proteins. The domain is involved in mediating protein-protein interactions through the binding of polyproline ligands. This gene encodes a WW domain binding protein. This gene also encodes a domain with similarity to the transcription elongation factor A, SII-related family. Alternative splicing results in multiple transcript variants encoding a single isoform. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 through 4 encode the same isoform. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC212121 | WBP5 (Myc-DDK-tagged)-Human WW domain binding protein 5 (WBP5), transcript variant 2 |
USD 98.00 |
|
RG212121 | WBP5 (GFP-tagged) - Human WW domain binding protein 5 (WBP5), transcript variant 2 |
USD 460.00 |
|
RC212121L3 | Lenti-ORF clone of WBP5 (Myc-DDK-tagged)-Human WW domain binding protein 5 (WBP5), transcript variant 2 |
USD 620.00 |
|
RC212121L4 | Lenti-ORF clone of WBP5 (mGFP-tagged)-Human WW domain binding protein 5 (WBP5), transcript variant 2 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review