WBP5 (TCEAL9) (NM_001006614) Human Untagged Clone

CAT#: SC301075

WBP5 (untagged)-Human WW domain binding protein 5 (WBP5), transcript variant 4


  "NM_001006614" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "TCEAL9"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TCEAL9
Synonyms WBP5; WEX6
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001006614, the custom clone sequence may differ by one or more nucleotides
ATGAAATCCTGTCAAAAAATGGAAGGAAAACCAGAAAATGAGAGTGAACCAAAGCATGAG
GAAGAGCCAAAGCCTGAGGAAAAGCCAGAAGAGGAGGAGAAGCTAGAGGAGGAGGCCAAA
GCAAAAGGAACTTTTAGAGAAAGGCTGATTCAATCTCTCCAGGAGTTTAAAGAAGATATA
CACAACAGGCATTTAAGCAATGAAGATATGTTTAGAGAAGTGGATGAAATAGATGAGATA
AGGAGAGTCAGAAACAAACTTATAGTGATGCGTTGGAAGGTTAATCGAAACCATCCTTAC
CCCTATTTAATGTAG
Restriction Sites Please inquire     
ACCN NM_001006614
ORF Size 315 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001006614.1, NP_001006615.1
RefSeq Size 1020
RefSeq ORF 315
Locus ID 51186
Gene Summary The globular WW domain is composed of 38 to 40 semiconserved amino acids shared by proteins of diverse functions including structural, regulatory, and signaling proteins. The domain is involved in mediating protein-protein interactions through the binding of polyproline ligands. This gene encodes a WW domain binding protein. This gene also encodes a domain with similarity to the transcription elongation factor A, SII-related family. Alternative splicing results in multiple transcript variants encoding a single isoform. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (4) differs in the 5' UTR compared to variant 1. Variants 1 through 4 encode the same isoform.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.