Gemin 7 (GEMIN7) (NM_001007270) Human Untagged Clone

CAT#: SC301203

GEMIN7 (untagged)-Human gem (nuclear organelle) associated protein 7 (GEMIN7), transcript variant 3


  "NM_001007270" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "GEMIN7"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol GEMIN7
Synonyms SIP3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001007270, the custom clone sequence may differ by one or more nucleotides


ATGCAAACTCCAGTGAACATTCCCGTGCCTGTGCTCCGGCTGCCCCGGGGCCCTGATGGCTTCAGCCGTG
GCTTTGCCCCTGATGGACGCAGAGCCCCCTTGAGGCCAGAGGTTCCTGAAATCCAGGAGTGTCCCATAGC
TCAAGAATCCCTGGAATCCCAGGAGCAGCGGGCACGAGCCGCCCTTCGGGAGCGTTACCTCCGCAGCCTG
CTGGCCATGGTGGGTCATCAGGTGAGCTTCACGTTGCACGAGGGTGTGCGTGTGGCCGCCCACTTTGGAG
CCACCGACCTGGATGTGGCCAACTTCTACGTGTCACAGCTGCAGACTCCCATAGGTGTGCAAGCAGAGGC
GCTGCTCCGATGTAGTGACATTATTTCATATACCTTCAAGCCATAA


Restriction Sites SgfI-MluI     
ACCN NM_001007270
ORF Size 396 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001007270.1, NP_001007271.1
RefSeq Size 1561
RefSeq ORF 396
Locus ID 79760
Protein Families Stem cell - Pluripotency
Gene Summary The protein encoded by this gene is a component of the core SMN complex, which is required for pre-mRNA splicing in the nucleus. The encoded protein is found in the nucleoplasm, in nuclear "gems" (Gemini of Cajal bodies), and in the cytoplasm. Three transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. All five variants encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.