Gemin 7 (GEMIN7) (NM_001007270) Human Untagged Clone
CAT#: SC301203
GEMIN7 (untagged)-Human gem (nuclear organelle) associated protein 7 (GEMIN7), transcript variant 3
"NM_001007270" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | GEMIN7 |
Synonyms | SIP3 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001007270, the custom clone sequence may differ by one or more nucleotides
ATGCAAACTCCAGTGAACATTCCCGTGCCTGTGCTCCGGCTGCCCCGGGGCCCTGATGGCTTCAGCCGTG GCTTTGCCCCTGATGGACGCAGAGCCCCCTTGAGGCCAGAGGTTCCTGAAATCCAGGAGTGTCCCATAGC TCAAGAATCCCTGGAATCCCAGGAGCAGCGGGCACGAGCCGCCCTTCGGGAGCGTTACCTCCGCAGCCTG CTGGCCATGGTGGGTCATCAGGTGAGCTTCACGTTGCACGAGGGTGTGCGTGTGGCCGCCCACTTTGGAG CCACCGACCTGGATGTGGCCAACTTCTACGTGTCACAGCTGCAGACTCCCATAGGTGTGCAAGCAGAGGC GCTGCTCCGATGTAGTGACATTATTTCATATACCTTCAAGCCATAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001007270 |
ORF Size | 396 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001007270.1, NP_001007271.1 |
RefSeq Size | 1561 |
RefSeq ORF | 396 |
Locus ID | 79760 |
Protein Families | Stem cell - Pluripotency |
Gene Summary | The protein encoded by this gene is a component of the core SMN complex, which is required for pre-mRNA splicing in the nucleus. The encoded protein is found in the nucleoplasm, in nuclear "gems" (Gemini of Cajal bodies), and in the cytoplasm. Three transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. All five variants encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC224525 | GEMIN7 (Myc-DDK-tagged)-Human gem (nuclear organelle) associated protein 7 (GEMIN7), transcript variant 3 |
USD 420.00 |
|
RG224525 | GEMIN7 (GFP-tagged) - Human gem (nuclear organelle) associated protein 7 (GEMIN7), transcript variant 3 |
USD 460.00 |
|
RC224525L3 | Lenti ORF clone of Human gem (nuclear organelle) associated protein 7 (GEMIN7), transcript variant 3, Myc-DDK-tagged |
USD 620.00 |
|
RC224525L4 | Lenti ORF clone of Human gem (nuclear organelle) associated protein 7 (GEMIN7), transcript variant 3, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review