CT45A5 (NM_001007551) Human Untagged Clone

CAT#: SC301242

CT45A5 (untagged)-Human cancer/testis antigen family 45, member A5 (CT45A5), transcript variant 1


  "NM_001007551" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "CT45A5"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CT45A5
Synonyms CT45-3; CT45-4; CT45-6; CT45.5; CT45A3; CT45A4; CT45A6; CT45A7; CT455
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001007551, the custom clone sequence may differ by one or more nucleotides


ATGACCGATAAAACAGAGAAGGTGGCTGTAGATCCTGAAACTGTGTTTAAACGTCCCAGGGAATGTGACA
GTCCTTCGTATCAGAAAAGGCAGAGGATGGCCCTGTTGGCAAGGAAACAAGGAGCAGGAGACAGCCTTAT
TGCAGGCTCTGCCATGTCCAAAGAAAAGAAGCTTATGACAGGACATGCTATTCCACCCAGCCAATTGGAT
TCTCAGATTGATGACTTCACTGGTTTCAGCAAAGATGGGATGATGCAGAAACCTGGTAGCAATGCACCTG
TGGGAGGAAACGTTACCAGCAGTTTCTCTGGAGATGACCTAGAATGCAGAGAAACAGCCTCCTCTCCCAA
AAGCCAACGAGAAATTAATGCTGATATAAAACGTAAATTAGTGAAGGAACTCCGATGCGTTGGACAAAAA
TATGAAAAAATCTTCGAAATGCTTGAAGGAGTGCAAGGACCTACTGCAGTCAGGAAGCGATTTTTTGAAT
CCATCATCAAGGAAGCAGCAAGATGTATGAGACGAGACTTTGTTAAGCACCTTAAGAAGAAACTGAAACG
TATGATTTGA


Restriction Sites SgfI-MluI     
ACCN NM_001007551
ORF Size 570 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001007551.4, NP_001007552.2
RefSeq Size 1321
RefSeq ORF 570
Locus ID 441521
Gene Summary This gene represents one of a cluster of several similar genes located on the q arm of chromosome X. The genes in this cluster encode members of the cancer/testis (CT) family of antigens, and are distinct from other CT antigens. These antigens are thought to be novel therapeutic targets for human cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
Transcript Variant: This variant (1) represents the shorter transcript. Both variants 1 and 2 encode the same protein. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. COMPLETENESS: complete on the 3' end.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.