CT45A5 (NM_001007551) Human Untagged Clone
CAT#: SC301242
CT45A5 (untagged)-Human cancer/testis antigen family 45, member A5 (CT45A5), transcript variant 1
"NM_001007551" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CT45A5 |
Synonyms | CT45-3; CT45-4; CT45-6; CT45.5; CT45A3; CT45A4; CT45A6; CT45A7; CT455 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001007551, the custom clone sequence may differ by one or more nucleotides
ATGACCGATAAAACAGAGAAGGTGGCTGTAGATCCTGAAACTGTGTTTAAACGTCCCAGGGAATGTGACA GTCCTTCGTATCAGAAAAGGCAGAGGATGGCCCTGTTGGCAAGGAAACAAGGAGCAGGAGACAGCCTTAT TGCAGGCTCTGCCATGTCCAAAGAAAAGAAGCTTATGACAGGACATGCTATTCCACCCAGCCAATTGGAT TCTCAGATTGATGACTTCACTGGTTTCAGCAAAGATGGGATGATGCAGAAACCTGGTAGCAATGCACCTG TGGGAGGAAACGTTACCAGCAGTTTCTCTGGAGATGACCTAGAATGCAGAGAAACAGCCTCCTCTCCCAA AAGCCAACGAGAAATTAATGCTGATATAAAACGTAAATTAGTGAAGGAACTCCGATGCGTTGGACAAAAA TATGAAAAAATCTTCGAAATGCTTGAAGGAGTGCAAGGACCTACTGCAGTCAGGAAGCGATTTTTTGAAT CCATCATCAAGGAAGCAGCAAGATGTATGAGACGAGACTTTGTTAAGCACCTTAAGAAGAAACTGAAACG TATGATTTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001007551 |
ORF Size | 570 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001007551.4, NP_001007552.2 |
RefSeq Size | 1321 |
RefSeq ORF | 570 |
Locus ID | 441521 |
Gene Summary | This gene represents one of a cluster of several similar genes located on the q arm of chromosome X. The genes in this cluster encode members of the cancer/testis (CT) family of antigens, and are distinct from other CT antigens. These antigens are thought to be novel therapeutic targets for human cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014] Transcript Variant: This variant (1) represents the shorter transcript. Both variants 1 and 2 encode the same protein. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. COMPLETENESS: complete on the 3' end. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC205570 | CT45A5 (Myc-DDK-tagged)-Human cancer/testis antigen family 45, member A5 (CT45A5), transcript variant 1 |
USD 98.00 |
|
RG205570 | CT45A5 (GFP-tagged) - Human cancer/testis antigen family 45, member A5 (CT45A5), transcript variant 1 |
USD 460.00 |
|
RC205570L3 | Lenti ORF clone of Human cancer/testis antigen family 45, member A5 (CT45A5), transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
RC205570L4 | Lenti ORF clone of Human cancer/testis antigen family 45, member A5 (CT45A5), transcript variant 1, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review