AKAP14 (NM_001008534) Human Untagged Clone

CAT#: SC301316

AKAP14 (untagged)-Human A kinase (PRKA) anchor protein 14 (AKAP14), transcript variant 2


  "NM_001008534" in other vectors (4)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "AKAP14"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol AKAP14
Synonyms AKAP28; PRKA14
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001008534, the custom clone sequence may differ by one or more nucleotides
ATGAGTGAGACTCAAAATTCAACAAGCCAGAAAGCAATGGATGAGGATAACAAAGCCGCA
AGCCAAACAATGCCGAATACACAAGACAAGAACTACGAGGATGAATTGACTCAAGTAGCT
CTAGCTCTGGTTGAGGATGTCATCAATTATGCTGTTAAGATTGTGGAAGAGGAGCGAAAC
CCTTTGAAAAACATCAAGTGGATGACTCACGGTGAATTCACTGTGGAAAAGGGTCTTAAA
CAAATTGACGAATATTTTTCGGATGCACCCATTGTTGTTTCTTATGTAGGTGACCACCAA
GCATTAGTTCACAGACCAGGAATGGTTCGCTTTCGAGAAAACTGGCAGAAGAATCTTACT
GATGCCAAATATAGTTTCATGGAGTCATTCCCCTTCTTATTCAATCGTGTCTGA
Restriction Sites Please inquire     
ACCN NM_001008534
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001008534.1, NP_001008534.1
RefSeq Size 675 bp
RefSeq ORF 414 bp
Locus ID 158798
Cytogenetics Xq24
Protein Families Druggable Genome
Gene Summary The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins, which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. The protein anchors PKA in ciliary axonemes and, in this way, may play a role in regulating ciliary beat frequency. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) lacks an alternate in-frame exon, compared to variant 1, resulting in a shorter protein (isoform b).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.