RBPMS (NM_001008710) Human Untagged Clone

CAT#: SC301350

RBPMS (untagged)-Human RNA binding protein with multiple splicing (RBPMS), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RBPMS
• Synonyms: HERMES
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001008710, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAACAACGGCGGCAAAGCCGAGAAGGAGAACACCCCGAGCGAGGCCAACCTTCAGGAGGAGGAGGTCC
  GGACCCTATTTGTCAGTGGCCTTCCTCTGGATATCAAACCTCGGGAGCTCTATCTGCTTTTCAGACCATT
  TAAGGGCTATGAGGGTTCTCTTATAAAGCTCACATCTAAACAGCCTGTAGGTTTTGTCAGTTTTGACAGT
  CGCTCAGAAGCAGAGGCTGCAAAGAATGCTTTGAATGGCATCCGCTTCGATCCTGAAATTCCGCAAACAC
  TACGACTAGAGTTTGCTAAGGCAAACACGAAGATGGCCAAGAACAAACTCGTAGGGACTCCAAACCCCAG
  TACTCCTCTGCCCAACACTGTACCTCAGTTCATTGCCAGAGAGCCATATGAGCTCACAGTGCCTGCACTT
  TACCCCAGTAGCCCTGAAGTGTGGGCCCCGTACCCTCTGTACCCAGCGGAGTTAGCGCCTGCTCTACCTC
  CTCCTGCTTTCACCTATCCCGCTTCACTGCATGCCCAGATGCGCTGGCTCCCTCCCTCCGAGGCTACTTC
  TCAGGGCTGGAAGTCCCGTCAGTTCTGCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001008710
• ORF Size: 591 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001008710.2, NP_001008710.1
• RefSeq Size: 2932
• RefSeq ORF: 591
• Locus ID: 11030
• Protein Families: Stem cell - Pluripotency
• Gene Summary: This gene encodes a member of the RNA recognition motif family of RNA-binding proteins. The RNA recognition motif is between 80-100 amino acids in length and family members contain one to four copies of the motif. The RNA recognition motif consists of two short stretches of conserved sequence, as well as a few highly conserved hydrophobic residues. The encoded protein has a single, putative RNA recognition motif in its N-terminus. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jun 2013]
  Transcript Variant: This variant (1) encodes isoform A. Variants 1 and 4 encode the same isoform.