RBPMS (NM_001008712) Human Untagged Clone

CAT#: SC301352

RBPMS (untagged)-Human RNA binding protein with multiple splicing (RBPMS), transcript variant 3


  "NM_001008712" in other vectors (5)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "RBPMS"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RBPMS
Synonyms HERMES
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001008712, the custom clone sequence may differ by one or more nucleotides


ATGAACAACGGCGGCAAAGCCGAGAAGGAGAACACCCCGAGCGAGGCCAACCTTCAGGAGGAGGAGGTCC
GGACCCTATTTGTCAGTGGCCTTCCTCTGGATATCAAACCTCGGGAGCTCTATCTGCTTTTCAGACCATT
TAAGGGCTATGAGGGTTCTCTTATAAAGCTCACATCTAAACAGCCTGTAGGTTTTGTCAGTTTTGACAGT
CGCTCAGAAGCAGAGGCTGCAAAGAATGCTTTGAATGGCATCCGCTTCGATCCTGAAATTCCGCAAACAC
TACGACTAGAGTTTGCTAAGGCAAACACGAAGATGGCCAAGAACAAACTCGTAGGGACTCCAAACCCCAG
TACTCCTCTGCCCAACACTGTACCTCAGTTCATTGCCAGAGAGCCATATGAGCTCACAGTGCCTGCACTT
TACCCCAGTAGCCCTGAAGTGTGGGCCCCGTACCCTCTGTACCCAGCGGAGTTAGCGCCTGCTCTACCTC
CTCCTGCTTTCACCTATCCCGCTTCACTGCATGCCCAGTGTTTCTCTCCTGAGGCAAAGCCCAACACACC
TGTCTTTTGTCCACTTCTCCAGCAAATTAGATTTGTCTCTGGGAATGTGTTTGTAACATACCAACCTACT
GCAGACCAGCAGAGGGAGCTCCCATGTTGA


Restriction Sites SgfI-MluI     
ACCN NM_001008712
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001008712.2, NP_001008712.1
RefSeq Size 1366 bp
RefSeq ORF 660 bp
Locus ID 11030
Cytogenetics 8p12
Protein Families Stem cell - Pluripotency
Gene Summary This gene encodes a member of the RNA recognition motif family of RNA-binding proteins. The RNA recognition motif is between 80-100 amino acids in length and family members contain one to four copies of the motif. The RNA recognition motif consists of two short stretches of conserved sequence, as well as a few highly conserved hydrophobic residues. The encoded protein has a single, putative RNA recognition motif in its N-terminus. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jun 2013]
Transcript Variant: This variant (3) lacks several exons and its 3'-terminal exon extends past a splice site that is used in variant 1. The encoded isoform (C) has a longer and distinct C-terminus, compared to isoform A.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.