HMGB4 (NM_001008728) Human Untagged Clone
CAT#: SC301356
HMGB4 (untagged)-Human high-mobility group box 4 (HMGB4), transcript variant 2
"NM_001008728" in other vectors (5)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | HMGB4 |
Synonyms | dJ1007G16.5; FLJ40388; MGC88128 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001008728, the custom clone sequence may differ by one or more nucleotides
ATGATGAATTATGTTGGCAAGAGGAAGAAACGGAGAAAGCGGGATCCCCAGGAACCCAGACGGCCTCCAT CATCCTTCCTACTCTTCTGCCAAGACCACTATGCTCAGCTGAAGAGGGAGAACCCGAACTGGTCGGTGGT GCAGGTGGCCAAGGCCACAGGGAAGATGTGGTCAACAGCGACAGACCTGGAGAAGCACCCTTATGAGCAA AGAGTGGCTCTCCTGAGAGCTAAGTACTTCGAGGAACTTGAACTCTACCGTAAACAATGTAATGCCAGGA AGAAGTACCGAATGTCAGCTAGAAACCGGTGCAGAGGGAAAAGAGTCAGGCAGAGCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001008728 |
ORF Size | 339 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001008728.1, NP_001008728.1 |
RefSeq Size | 686 |
RefSeq ORF | 339 |
Locus ID | 127540 |
Protein Families | Transcription Factors |
Gene Summary | Belongs to the HMGB family. [UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) lacks an internal segment including 5' coding region, as compared variant 1. The encoded isoform 2 has a shorter N-terminus, as compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
SC321031 | HMGB4 (untagged)-Human high-mobility group box 4 (HMGB4), transcript variant 2 |
USD 420.00 |
|
RC209978 | HMGB4 (Myc-DDK-tagged)-Human high-mobility group box 4 (HMGB4), transcript variant 2 |
USD 98.00 |
|
RG209978 | HMGB4 (GFP-tagged) - Human high-mobility group box 4 (HMGB4), transcript variant 2 |
USD 460.00 |
|
RC209978L3 | Lenti ORF clone of Human high-mobility group box 4 (HMGB4), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC209978L4 | Lenti ORF clone of Human high-mobility group box 4 (HMGB4), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review