IL32 (NM_001012633) Human Untagged Clone

CAT#: SC301682

IL32 (untagged)-Human interleukin 32 (IL32), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: IL32
• Synonyms: IL-32alpha; IL-32beta; IL-32delta; IL-32gamma; NK4; TAIF; TAIFa; TAIFb; TAIFc; TAIFd
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene ORF sequence for NM_001012633 edited
  ATGTGCTTCCCGAAGGTCCTCTCTGATGACATGAAGAAGCTGAAGGCCCGAATGCACCAG
  GCCATAGAAAGATTTTATGATAAAATGCAAAATGCAGAATCAGGACGTGGACAGGTGATG
  TCGAGCCTGGCAGAGCTGGAGGACGACTTCAAAGAGGGCTACCTGGAGACAGTGGCGGCT
  TATTATGAGGAGCAGCACCCAGAGCTCACTCCTCTATTTGAAAAAGAAAGAGATGGATTA
  CGGTGCCGAGGCAACAGATCCCCTGTCCCGGATGTTGAGGATCCCGCAACCGAGGAGCCT
  GGGGAGAGCTTTTGTGACAAGTCCTACGGAGCCCCACGGGGGGACAAGGAGGAGCTGACA
  CCCCAGAAGTGCTCTGAACCCCAATCCTCAAAATGA
  
  5' Read Nucleotide Sequence

  >OriGene 5' read for NM_001012633 unedited
  CACGAGGGGTGACTGTCTCAGTGGAGCTGGGTCATCTCAGGCCTTGGCTCCTTGAACTTT
  TGGCCGCCATGTGCTTCCCGAAGGTCCTCTCTGATGACATGAAGAAGCTGAAGGCCCGAA
  TGCACCAGGCCATAGAAAGATTTTATGATAAAATGCAAAATGCAGAATCAGGACGTGGAC
  AGGTGATGTCGAGCCTGGCAGAGCTGGAGGACGACTTCAAAGAGGGCTACCTGGAGACAG
  TGGCGGCTTATTATGAGGAGCAGCACCCAGAGCTCACTCCTCTATTTGAAAAAGAAAGAG
  ATGGATTACGGTGCCGAGGCAACAGATCCCCTGTCCCGGATGTTGAGGATCCCGCAACCG
  AGGAGCCTGGGGAGAGCTTTTGTGACAAGTCCTACGGAGCCCCACGGGGGGACAAGGAGG
  AGCTGACACCCCAGAAGTGCTCTGAACCCCAATCCTCAAAATGAAGATACTGACACCACC
  TTTGCCCTCCCCGTCACCGCGCACCCACCCTGACCCCTCCCTCAGCTGTCCTGTGCCCCG
  CCCTCTCCCGCACACTCAGTCCCCCTGCCTGGCGTTCCTGCCGCAGCTCTGACCTGGTGC
  TGTCGCCCTGGCATCTTAATAAAACCTGCTTATACTTCCCTGGC
  
• Restriction Sites: Please inquire
• ACCN: NM_001012633
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: There is 1 nucleotide difference between the OriGene clone and the NCBI reference ORF. OriGene considers this to be a polymorphism and to reflect the natural differences between individuals. This results in the substitution of 1 amino acid.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001012633.1, NP_001012651.1
• RefSeq Size: 919 bp
• RefSeq ORF: 396 bp
• Locus ID: 9235
• Cytogenetics: 16p13.3
• Protein Families: Secreted Protein
• Gene Summary: This gene encodes a member of the cytokine family. The protein contains a tyrosine sulfation site, 3 potential N-myristoylation sites, multiple putative phosphorylation sites, and an RGD cell-attachment sequence. Expression of this protein is increased after the activation of T-cells by mitogens or the activation of NK cells by IL-2. This protein induces the production of TNFalpha from macrophage cells. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (4) lacks an alternate exon in the 5' UTR and contains an alternate intron within the last exon of the coding region, compared to variant 1. The encoded isoform (A), also referred to as IL-32alpha, is shorter compared to isoform B. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.