IL32 (NM_001012718) Human Untagged Clone

CAT#: SC301707

IL32 (untagged)-Human interleukin 32 (IL32), transcript variant 8

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: IL32
• Synonyms: IL-32alpha; IL-32beta; IL-32delta; IL-32gamma; NK4; TAIF; TAIFa; TAIFb; TAIFc; TAIFd
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001012718, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTGCTTCCCGAAGGTCCTCTCTGATGACATGAAGAAGCTGAAGGCCCGAATGCACCAGGCCATAGAAA
  GATTTTATGATAAAATGCAAAATGCAGAATCAGGACGTGGACAGGTGATGTCGAGCCTGGCAGAGCTGGA
  GGACGACTTCAAAGAGGGCTACCTGGAGACAGTGGCGGCTTATTATGAGGAGCAGCACCCAGAGCTCACT
  CCTCTACTTGAAAAAGAAAGAGATGGATTACGGTGCCGAGGCAACAGATCCCCTGTCCCGGATGTTGAGG
  ATCCCGCAACCGAGGAGCCTGGGGAGAGCTTTTGTGACAAGGTCATGAGATGGTTCCAGGCCATGCTGCA
  GCGGCTGCAGACCTGGTGGCACGGGGTTCTGGCCTGGGTGAAGGAGAAGGTGGTGGCCCTGGTCCATGCA
  GTGCAGGCCCTCTGGAAACAGTTCCAGAGTTTCTGCTGCTCTCTGTCAGAGCTCTTCATGTCCTCTTTCC
  AGTCCTACGGAGCCCCACGGGGGGACAAGGAGGAGCTGACACCCCAGAAGTGCTCTGAACCCCAATCCTC
  AAAATGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001012718
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001012718.1, NP_001012736.1
• RefSeq Size: 1093 bp
• RefSeq ORF: 567 bp
• Locus ID: 9235
• Cytogenetics: 16p13.3
• Protein Families: Secreted Protein
• Gene Summary: This gene encodes a member of the cytokine family. The protein contains a tyrosine sulfation site, 3 potential N-myristoylation sites, multiple putative phosphorylation sites, and an RGD cell-attachment sequence. Expression of this protein is increased after the activation of T-cells by mitogens or the activation of NK cells by IL-2. This protein induces the production of TNFalpha from macrophage cells. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (8) contains an alternate in-frame splice site in the 5' UTR compared to variant 1. Variants 1 and 8 encode the same protein, isoform B, also referred to as IL-32beta. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.