RGR (NM_001012720) Human Untagged Clone

CAT#: SC301708

RGR (untagged)-Human retinal G protein coupled receptor (RGR), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RGR
• Synonyms: RP44
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001012720, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCAGAGACCAGTGCCCTGCCCACTGGCTTCGGGGAGCTCGAGGTGCTGGCTGTGGGGATGGTGCTAC
  TGGTGGAAGCTCTCTCCGGTCTCAGCCTCAATACCCTGACCATCTTCTCTTTCTGCAAGACCCCGGAGCT
  GCGGACTCCCTGCCACCTACTGGTGCTGAGCTTGGCTCTTGCGGACAGTGGGATCAGCCTGAATGCCCTC
  GTTGCAGCCACATCCAGCCTTCTCCGGCGCTGGCCCTACGGCTCGGACGGCTGCCAGGCTCACGGCTTCC
  AGGGCTTTGTGACAGCGTTGGCCAGCATCTGCAGCAGTGCAGCCATCGCATGGGGGCGTTATCACCACTA
  CTGCACCCGTAGCCAGCTGGCCTGGAACTCAGCCGTCTCTCTGGTGCTCTTCGTGTGGCTGTCTTCTGCC
  TTCTGGGCAGCTCTGCCCCTTCTGGGTTGGGGTCACTACGACTATGAGCCACTGGGGACATGCTGCACCC
  TGGACTACTCCAAGGGGGACAGAAACTTCACCAGCTTCCTCTTCACCATGTCCTTCTTCAACTTCGCCAT
  GCCCCTCTTCATCACGATCACTTCCTACAGTCTCATGGAGCAGAAACTGGGGAAGAGTGGCCATCTCCAG
  GTAAACACCACTCTGCCAGCAAGGACGCTGCTGCTCGGCTGGGGCCCCTATGCCATCCTGTATCTATACG
  CAGTCATCGCAGACGTGACTTCCATCTCCCCCAAACTGCAGATGGTGCCCGCCCTCATTGCCAAAATGGT
  GCCCACGATCAATGCCATCAACTATGCCCTGGGCAATGAGATGGTCTGCAGGGGAATCTGGCAGTGCCTC
  TCACCGCAGAAGAGGGAGAAGGACCGAACCAAGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001012720
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001012720.1, NP_001012738.1
• RefSeq Size: 1463 bp
• RefSeq ORF: 876 bp
• Locus ID: 5995
• Cytogenetics: 10q23.1
• Protein Families: Druggable Genome, GPCR, Transmembrane
• Gene Summary: 'This gene encodes a putative retinal G-protein coupled receptor. The gene is a member of the opsin subfamily of the 7 transmembrane, G-protein coupled receptor 1 family. Like other opsins which bind retinaldehyde, it contains a conserved lysine residue in the seventh transmembrane domain. The protein acts as a photoisomerase to catalyze the conversion of all-trans-retinal to 11-cis-retinal. The reverse isomerization occurs with rhodopsin in retinal photoreceptor cells. The protein is exclusively expressed in tissue adjacent to retinal photoreceptor cells, the retinal pigment epithelium and Mueller cells. This gene may be associated with autosomal recessive and autosomal dominant retinitis pigmentosa (arRP and adRP, respectively). Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]'
  Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 5' coding region, compared to variant 1, resulting in a shorter protein (isoform 2), compared to isoform 1.