Epigen (EPGN) (NM_001013442) Human Untagged Clone
CAT#: SC301789
EPGN (untagged)-Human epithelial mitogen homolog (mouse) (EPGN)
"NM_001013442" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | EPGN |
Synonyms | ALGV3072; EPG; epigen; PRO9904 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001013442, the custom clone sequence may differ by one or more nucleotides
ATGGCTTTGGGAGTTCCAATATCAGTCTATCTTTTATTCAACGCAATGACAGCACTGACCGAAGAGGCAG CCGTGACTGTAACACCTCCAATCACAGCCCAGCAAGCTGACAACATAGAAGGACCCATAGCCTTGAAGTT CTCACACCTTTGCCTGGAAGATCATAACAGTTACTGCATCAACGGTGCTTGTGCATTCCACCATGAGCTA GAGAAAGCCATCTGCAGGTGTTTTACTGGTTATACTGGAGAAAGGTGTGAGCACTTGACTTTAACTTCAT ATGCTGTGGATTCTTATGAAAAATACATTGCAATTGGGATTGGTGTTGGATTACTATTAAGTGGTTTTCT TGTTATTTTTTACTGCTATATAAGAAAGAGGTATGAAAAAGACAAAATATGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001013442 |
ORF Size | 402 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001013442.1, NP_001013460.1 |
RefSeq Size | 847 |
RefSeq ORF | 402 |
Locus ID | 255324 |
Protein Families | Transmembrane |
Gene Summary | The protein encoded by this gene is a member of the epidermal growth factor family. Members of this family are ligands for the epidermal growth factor receptor and play a role in cell survival, proliferation and migration. This protein has been reported to have high mitogenic activity but low affinity for its receptor. Expression of this transcript and protein have been reported in cancer specimens of the breast, bladder, and prostate. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC214501 | EPGN (Myc-DDK-tagged)-Human epithelial mitogen homolog (mouse) (EPGN) |
USD 98.00 |
|
RG214501 | EPGN (GFP-tagged) - Human epithelial mitogen homolog (mouse) (EPGN) |
USD 460.00 |
|
RC214501L1 | Lenti ORF clone of Human epithelial mitogen homolog (mouse) (EPGN), Myc-DDK-tagged |
USD 620.00 |
|
RC214501L2 | Lenti ORF clone of Human epithelial mitogen homolog (mouse) (EPGN), mGFP tagged |
USD 620.00 |
|
RC214501L3 | Lenti ORF clone of Human epithelial mitogen homolog (mouse) (EPGN), Myc-DDK-tagged |
USD 620.00 |
|
RC214501L4 | Lenti ORF clone of Human epithelial mitogen homolog (mouse) (EPGN), mGFP tagged |
USD 768.00 |
{0} Product Review(s)
Be the first one to submit a review