CA7 (NM_001014435) Human Untagged Clone

CAT#: SC301933

CA7 (untagged)-Human carbonic anhydrase VII (CA7), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CA7
• Synonyms: CA-VII; CAVII
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001014435, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTCCCTCAGCATCACCAACAATGGCCACTCTGTCCAGGTAGACTTCAATGACAGCGATGACCGAACCG
  TGGTGACTGGGGGCCCCCTGGAAGGGCCCTACCGCCTCAAGCAGTTTCACTTCCACTGGGGCAAGAAGCA
  CGATGTGGGTTCTGAGCACACGGTGGACGGCAAGTCCTTCCCCAGCGAGCTGCATCTGGTTCACTGGAAT
  GCCAAGAAGTACAGCACTTTTGGGGAGGCGGCCTCAGCACCTGATGGCCTGGCTGTGGTTGGTGTTTTTT
  TGGAGACAGGAGACGAGCACCCCAGCATGAATCGTCTGACAGATGCGCTCTACATGGTCCGGTTCAAGGG
  CACCAAAGCCCAGTTCAGCTGCTTCAACCCCAAGTGCCTCCTGCCTGCCAGCCGGCACTACTGGACCTAC
  CCGGGCTCTCTGACGACTCCCCCACTCAGTGAGAGTGTCACCTGGATTGTGCTCCGGGAGCCCATCTGCA
  TCTCTGAAAGGCAGATGGGGAAGTTCCGGAGCCTGCTTTTTACCTCGGAGGACGATGAGAGGATCCACAT
  GGTGAACAACTTCCGGCCACCACAGCCACTGAAGGGCCGCGTGGTAAAGGCCTCCTTCCGGGCCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001014435
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001014435.1, NP_001014435.1
• RefSeq Size: 1715 bp
• RefSeq ORF: 627 bp
• Locus ID: 766
• Cytogenetics: 16q22.1
• Protein Families: Druggable Genome
• Protein Pathways: Nitrogen metabolism
• Gene Summary: 'Carbonic anhydrases are a large family of zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide. They participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva, and gastric acid. They show extensive diversity in tissue distribution and in their subcellular localization. The cytosolic protein encoded by this gene is predominantly expressed in the brain and contributes to bicarbonate driven GABAergic neuron excitation. Alternative splicing in the coding region results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2018]'
  Transcript Variant: This variant (2) has a distinct 5' UTR and uses a downstream start codon compared to variant 1. It encodes isoform 2 which has a shorter N-terminus compared to isoform 1. Variants 2 and 3 encode the same protein. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.