CUTA (NM_001014840) Human Untagged Clone

CAT#: SC301967

CUTA (untagged)-Human cutA divalent cation tolerance homolog (E. coli) (CUTA), transcript variant 5

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CUTA
• Synonyms: ACHAP; C6orf82
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001014840, the custom clone sequence may differ by one or more nucleotides
  ATGAGTGGGGGGCGGGCTCCCGCGGTCCTGCTCGGCGGAGTGGCCTCTCTGCTCCTGTCT
  TTTGTTTGGATGCCGGCGCTGCTGCCTGTGGCCTCCCGCCTTTTGTTGCTACCCCGAGTC
  TTGCTGACCATGGCCTCTGGAAGCCCTCCGACCCAGCCCTCGCCGGCCTCGGATTCCGGC
  TCTGGCTACGTTCCGGGCTCGGTCTCTGCAGCCTTTGTTACTTGCCCCAACGAGAAGGTC
  GCCAAGGAGATCGCCAGGGCCGTGGTGGAGAAGCGCCTAGCAGCCTGCGTCAACCTCATC
  CCTCAGATTACATCCATCTATGAGTGGAAAGGGAAGATCGAGGAAGACAGTGAGGTGCTG
  ATGATGATTAAAACCCAAAGTTCCTTGGTCCCAGCTTTGACAGATTTTGTTCGTTCTGTG
  CACCCTTACGAAGTGGCCGAGGTAATTGCATTGCCTGTGGAACAGGGGAACTTTCCGTAC
  CTGCAGTGGGTGCGCCAGGTCACAGAGTCAGTTTCTGACTCTATCACAGTCCTGCCATGA
  
• Restriction Sites: Please inquire
• ACCN: NM_001014840
• ORF Size: 540 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001014840.1, NP_001014840.1
• RefSeq Size: 951
• RefSeq ORF: 540
• Locus ID: 51596
• Protein Families: Transmembrane
• Gene Summary: May form part of a complex of membrane proteins attached to acetylcholinesterase (AChE). [UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (5) uses an alternate splice site in the 5' coding region, compared to variant 1, resulting in a shorter protein (isoform 3). Isoform 3 has also been called isoform b.