LAT (NM_001014989) Human Untagged Clone

CAT#: SC301979

LAT (untagged)-Human linker for activation of T cells (LAT), transcript variant 4


  "NM_001014989" in other vectors (4)

Reconstitution Protocol

USD 660.00

4 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol LAT
Synonyms IMD52; LAT1; pp36
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001014989, the custom clone sequence may differ by one or more nucleotides
ATGGAGGCCACGGCTGCCAGCTGGCAGGTGGCTGTCCCCGTCTTGGGGGGGGCCAGCAGA
CCCTTGGGGCCTAGGGGTGCAGCCAGCCTGCTCCGAGCTCCCCTGCAGATGGAGGAGGCC
ATCCTGGTCCCCTGCGTGCTGGGGCTCCTGCTGCTGCCCATCCTGGCCATGTTGATGGCA
CTGTGTGTGCACTGCCACAGACTGCCAGGCTCCTACGACAGCACATCCTCAGATAGTTTG
TATCCAAGGGGCATCCAGTTCAAACGGCCTCACACGGTTGCCCCCTGGCCACCTGCCTAC
CCACCTGTCACCTCCTACCCACCCCTGAGCCAGCCAGACCTGCTCCCCATCCCAAGATCC
CCGCAGCCCCTTGGGGGCTCCCACCGGACGCCATCTTCCCGGCGGGATTCTGATGGTGCC
AACAGTGTGGCGAGCTACGAGAACGAGGAACCAGCCTGTGAGGATGCGGATGAGGATGAG
GACGACTATCACAACCCAGGCTACCTGGTGGTGCTTCCTGACAGCACCCCGGCCACTAGC
ACTGCTGCCCCATCAGCTCCTGCACTCAGCACCCCTGGCATCCGAGACAGTGCCTTCTCC
ATGGAGTCCATTGATGATTACGTGAACGTTCCGGAGAGCGGGGAGAGCGCAGAAGCGTCT
CTGGATGGCAGCCGGGAGTATGTGAATGTGTCCCAGGAACTGCATCCTGGAGCGGCTAAG
ACTGAGCCTGCCGCCCTGAGTTCCCAGGAGGCAGAGGAAGTGGAGGAAGAGGGGGCTCCA
GATTACGAGAATCTGCAGGAGCTGAACTGA
Restriction Sites Please inquire     
ACCN NM_001014989
ORF Size 810 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001014989.1, NP_001014989.2
RefSeq Size 1472
RefSeq ORF 810
Locus ID 27040
Protein Families Druggable Genome, Transmembrane
Protein Pathways Fc epsilon RI signaling pathway, Fc gamma R-mediated phagocytosis, Natural killer cell mediated cytotoxicity, T cell receptor signaling pathway
Gene Summary The protein encoded by this gene is phosphorylated by ZAP-70/Syk protein tyrosine kinases following activation of the T-cell antigen receptor (TCR) signal transduction pathway. This transmembrane protein localizes to lipid rafts and acts as a docking site for SH2 domain-containing proteins. Upon phosphorylation, this protein recruits multiple adaptor proteins and downstream signaling molecules into multimolecular signaling complexes located near the site of TCR engagement. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (4) encodes the longest isoform (d).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.