LAT (NM_001014989) Human Untagged Clone
CAT#: SC301979
LAT (untagged)-Human linker for activation of T cells (LAT), transcript variant 4
"NM_001014989" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | LAT |
Synonyms | IMD52; LAT1; pp36 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001014989, the custom clone sequence may differ by one or more nucleotides
ATGGAGGCCACGGCTGCCAGCTGGCAGGTGGCTGTCCCCGTCTTGGGGGGGGCCAGCAGA CCCTTGGGGCCTAGGGGTGCAGCCAGCCTGCTCCGAGCTCCCCTGCAGATGGAGGAGGCC ATCCTGGTCCCCTGCGTGCTGGGGCTCCTGCTGCTGCCCATCCTGGCCATGTTGATGGCA CTGTGTGTGCACTGCCACAGACTGCCAGGCTCCTACGACAGCACATCCTCAGATAGTTTG TATCCAAGGGGCATCCAGTTCAAACGGCCTCACACGGTTGCCCCCTGGCCACCTGCCTAC CCACCTGTCACCTCCTACCCACCCCTGAGCCAGCCAGACCTGCTCCCCATCCCAAGATCC CCGCAGCCCCTTGGGGGCTCCCACCGGACGCCATCTTCCCGGCGGGATTCTGATGGTGCC AACAGTGTGGCGAGCTACGAGAACGAGGAACCAGCCTGTGAGGATGCGGATGAGGATGAG GACGACTATCACAACCCAGGCTACCTGGTGGTGCTTCCTGACAGCACCCCGGCCACTAGC ACTGCTGCCCCATCAGCTCCTGCACTCAGCACCCCTGGCATCCGAGACAGTGCCTTCTCC ATGGAGTCCATTGATGATTACGTGAACGTTCCGGAGAGCGGGGAGAGCGCAGAAGCGTCT CTGGATGGCAGCCGGGAGTATGTGAATGTGTCCCAGGAACTGCATCCTGGAGCGGCTAAG ACTGAGCCTGCCGCCCTGAGTTCCCAGGAGGCAGAGGAAGTGGAGGAAGAGGGGGCTCCA GATTACGAGAATCTGCAGGAGCTGAACTGA |
Restriction Sites | Please inquire |
ACCN | NM_001014989 |
ORF Size | 810 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001014989.1, NP_001014989.2 |
RefSeq Size | 1472 |
RefSeq ORF | 810 |
Locus ID | 27040 |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | Fc epsilon RI signaling pathway, Fc gamma R-mediated phagocytosis, Natural killer cell mediated cytotoxicity, T cell receptor signaling pathway |
Gene Summary | The protein encoded by this gene is phosphorylated by ZAP-70/Syk protein tyrosine kinases following activation of the T-cell antigen receptor (TCR) signal transduction pathway. This transmembrane protein localizes to lipid rafts and acts as a docking site for SH2 domain-containing proteins. Upon phosphorylation, this protein recruits multiple adaptor proteins and downstream signaling molecules into multimolecular signaling complexes located near the site of TCR engagement. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (4) encodes the longest isoform (d). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC212487 | LAT (Myc-DDK-tagged)-Human linker for activation of T cells (LAT), transcript variant 4 |
USD 420.00 |
|
RG212487 | LAT (GFP-tagged) - Human linker for activation of T cells (LAT), transcript variant 4 |
USD 460.00 |
|
RC212487L3 | Lenti-ORF clone of LAT (Myc-DDK-tagged)-Human linker for activation of T cells (LAT), transcript variant 4 |
USD 620.00 |
|
RC212487L4 | Lenti-ORF clone of LAT (mGFP-tagged)-Human linker for activation of T cells (LAT), transcript variant 4 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review