AK6 (NM_001015891) Human Untagged Clone

CAT#: SC302013

TAF9 (untagged)-Human TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa (TAF9), transcript variant 3


  "NM_001015891" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol AK6
Synonyms AD-004; CGI-137; CINAP; CIP; hCINAP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001015891, the custom clone sequence may differ by one or more nucleotides


ATGTGTCATCGAAAGCCAGGTACACCAGGGGTTGGAAAAACCACACTAGGCAAAGAACTTGCGTCAAAAT
CAGGACTGAAATACATTAATGTGGGTGATTTAGCTCGAGAAGAGCAATTGTATGATGGCTATGATGAAGA
GTATGACTGTCCCATTTTAGATGAAGACAGAGTAGTTGATGAGTTAGATAACCAAATGAGAGAAGGTGGA
GTTATTGTTGATTACCATGGTTGTGATTTCTTCCCTGAACGCTGGTTTCATATAGTTTTTGTGCTGAGAA
CAGATACCAATGTATTGTACGAAAGACTTGAAACAAGGGGTTATAATGAGAAGAAACTAACAGACAATAT
TCAGTGTGAGATTTTTCAAGTTCTTTATGAAGAAGCCACAGCATCCTACAAGGAAGAAATCGTGCATCAG
CTGCCCAGTAATAAACCAGAAGAGCTAGAAAATAATGTAGATCAGATCTTGAAATGGATTGAGCAGTGGA
TCAAAGATCATAACTCTTGA


Restriction Sites SgfI-MluI     
ACCN NM_001015891
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001015891.1, NP_001015891.1
RefSeq Size 1199 bp
RefSeq ORF 510 bp
Locus ID 102157402
Cytogenetics 5q13.2
Gene Summary This gene encodes a protein that belongs to the adenylate kinase family of enzymes. The protein has a nuclear localization and contains Walker A (P-loop) and Walker B motifs and a metal-coordinating residue. The protein may be involved in regulation of Cajal body formation. In human, AK6 and TAF9 (GeneID: 6880) are two distinct genes that share 5' exons. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Transcript Variant: This variant (3) contains an alternate exon in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at an alternate start codon, compared to variant 2. The encoded isoform (c) has a distinct N-terminus and is shorter than isoform b.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.