C4BPB (NM_001017364) Human Untagged Clone
CAT#: SC302017
C4BPB (untagged)-Human complement component 4 binding protein, beta (C4BPB), transcript variant 2
"NM_001017364" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | C4BPB |
Synonyms | C4BP |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001017364, the custom clone sequence may differ by one or more nucleotides
ATGTTTTTTTGGTGTGCGTGCTGTCTTATGGTTGCGTGGCGAGTTTCTGCTTCAGATGAGCACTGTCCAG AGCTTCCTCCAGTGGACAATAGCATATTTGTCGCAAAGGAGGTGGAAGGACAGATTCTGGGGACTTACGT TTGTATCAAGGGCTACCACCTGGTAGGAAAGAAGACCCTTTTTTGCAATGCCTCTAAGGAGTGGGATAAC ACCACTACTGAGTGCCGCTTGGGCCACTGTCCTGATCCTGTGCTGGTGAATGGAGAGTTCAGTTCTTCAG GGCCTGTGAATGTAAGTGACAAAATCACGTTTATGTGCAATGACCACTACATCCTCAAGGGCAGCAATCG GAGCCAGTGTCTAGAGGACCACACCTGGGCACCTCCCTTTCCCATCTGCAAAAGTAGGGACTGTGACCCT CCTGGGAATCCAGTTCATGGCTATTTTGAAGGAAATAACTTCACCTTAGGATCCACCATTAGTTATTACT GTGAAGACAGGTACTACTTAGTGGGCGTGCAGGAGCAGCAATGCGTTGATGGGGAGTGGAGCAGTGCACT TCCAGTCTGCAAGTTGATCCAGGAAGCTCCCAAACCAGAGTGTGAGAAGGCACTTCTTGCCTTTCAGGAG AGTAAGAACCTCTGCGAAGCCATGGAGAACTTTATGCAACAATTAAAGGAAAGTGGCATGACAATGGAGG AGCTAAAATATTCTCTGGAGCTGAAGAAAGCTGAGTTGAAGGCAAAATTGTTGTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001017364 |
ORF Size | 756 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001017364.1, NP_001017364.1 |
RefSeq Size | 1128 |
RefSeq ORF | 756 |
Locus ID | 725 |
Protein Pathways | Complement and coagulation cascades |
Gene Summary | This gene encodes a member of a superfamily of proteins composed predominantly of tandemly arrayed short consensus repeats of approximately 60 amino acids. A single, unique beta-chain encoded by this gene assembles with seven identical alpha-chains into the predominant isoform of C4b-binding protein, a multimeric protein that controls activation of the complement cascade through the classical pathway. C4b-binding protein has a regulatory role in the coagulation system also, mediated through the beta-chain binding of protein S, a vitamin K-dependent protein that serves as a cofactor of activated protein C. The genes encoding both alpha and beta chains are located adjacent to each other on human chromosome 1 in the regulator of complement activation gene cluster. Alternative splicing gives rise to multiple transcript variants. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) uses an alternate, in-frame splice site in the 5' coding region, compared to variant 1. Variants 2 and 4 encode isoform 2, which has a shorter N-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC219158 | C4BPB (Myc-DDK-tagged)-Human complement component 4 binding protein, beta (C4BPB), transcript variant 2 |
USD 420.00 |
|
RG219158 | C4BPB (GFP-tagged) - Human complement component 4 binding protein, beta (C4BPB), transcript variant 2 |
USD 460.00 |
|
RC219158L3 | Lenti ORF clone of Human complement component 4 binding protein, beta (C4BPB), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC219158L4 | Lenti ORF clone of Human complement component 4 binding protein, beta (C4BPB), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review