SULT1A4 (NM_001017389) Human Untagged Clone
CAT#: SC302029
SULT1A4 (untagged)-Human sulfotransferase family, cytosolic, 1A, phenol-preferring, member 4 (SULT1A4), transcript variant 1
"NM_001017389" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | SULT1A4 |
Synonyms | aryl sulfotransferase; phenol sulfotransferase; sulfokinase; sulfotransferase family, cytosolic, 1A, phenol-preferring, member 4 |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001017389, the custom clone sequence may differ by one or more nucleotides
ATGGAGCTGATCCAGGACACCTCCCGCCCGCCACTGGAGTACGTGAAGGGGGTCCCGCTCATCAAGTACT TTGCAGAGGCACTGGGGCCCCTGCAGAGCTTCCAAGCCCGACCTGATGACCTGCTCATCAACACCTACCC CAAGTCTGGCACCACCTGGGTGAGCCAGATACTGGACATGATCTACCAGGGCGGCGACCTAGAGAAGTGT AACCGGGCTCCCATCTACGTACGGGTGCCCTTCCTTGAGGTCAATGATCCAGGGGAACCCTCAGGGCTGG AGACTCTGAAAGACACACCGCCCCCACGGCTCATCAAGTCACACCTGCCCCTGGCTCTGCTCCCTCAGAC TCTGTTGGATCAGAAGGTCAAGGTGGTCTATGTTGCCCGAAACCCAAAGGACGTGGCGGTCTCCTACTAC CATTTCCACCGTATGGAAAAGGCGCACCCTGAGCCTGGGACCTGGGACAGCTTCCTGGAAAAGTTCATGG CTGGAGAAGTGTCCTACGGGTCCTGGTACCAGCACGTGCAGGAGTGGTGGGAGCTGAGCCGCACCCACCC TGTTCTCTACCTCTTCTATGAAGACATGAAGGAGAACCCCAAAAGGGAGATTCAAAAGATCCTGGAGTTT GTGGGGCGCTCCCTGCCAGAGGAGACCATGGACTTCATGGTTCAGCACACGTCGTTCAAGGAGATGAAGA AGAACCCTATGACCAACTACACCACCGTCCCCCAGGAGCTCATGGACCACAGCATCTCCCCCTTCATGAG GAAAGGCATGGCTGGGGACTGGAAGACCACCTTCACCGTGGCGCAGAATGAGCGCTTCGATGCGGACTAT GCGGAGAAGATGGCAGGCTGCAGCCTCAGCTTCCGCTCTGAGCTGTGA |
Restriction Sites | NotI-NotI |
ACCN | NM_001017389 |
ORF Size | 888 bp |
Insert Size | 1100 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001017389.1, NP_001017389.1 |
RefSeq Size | 1574 |
RefSeq ORF | 888 |
Locus ID | 445329 |
Protein Pathways | Sulfur metabolism |
Gene Summary | Sulfotransferase enzymes catalyze the sulfate conjugation of many hormones, neurotransmitters, drugs, and xenobiotic compounds. These cytosolic enzymes are different in their tissue distributions and substrate specificities. The gene structure (number and length of exons) is similar among family members. This gene encodes a phenol sulfotransferase with thermolabile enzyme activity. Four sulfotransferase genes are located on the p arm of chromosome 16, this gene and SULT1A3 arose from a segmental duplication. Read-through transcription exists between this gene and the upstream SLX1B (SLX1 structure-specific endonuclease subunit homolog B) gene that encodes a protein containing GIY-YIG domains. [provided by RefSeq, Nov 2010] Transcript Variant: This variant (1) is the longest variant. Variants 1 and 2 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC222321 | SULT1A4 (Myc-DDK-tagged)-Human sulfotransferase family, cytosolic, 1A, phenol-preferring, member 4 (SULT1A4), transcript variant 1 |
USD 420.00 |
|
RG222321 | SULT1A4 (GFP-tagged) - Human sulfotransferase family, cytosolic, 1A, phenol-preferring, member 4 (SULT1A4), transcript variant 1 |
USD 460.00 |
|
RC222321L3 | Lenti ORF clone of Human sulfotransferase family, cytosolic, 1A, phenol-preferring, member 4 (SULT1A4), transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
RC222321L4 | Lenti ORF clone of Human sulfotransferase family, cytosolic, 1A, phenol-preferring, member 4 (SULT1A4), transcript variant 1, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review