CCXCR1 (XCR1) (NM_001024644) Human Untagged Clone

CAT#: SC302272

XCR1 (untagged)-Human chemokine (C motif) receptor 1 (XCR1), transcript variant 2


  "NM_001024644" in other vectors (4)

Reconstitution Protocol

USD 760.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "XCR1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol XCR1
Synonyms CCXCR1; GPR5
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001024644, the custom clone sequence may differ by one or more nucleotides


ATGGAGTCCTCAGGCAACCCAGAGAGCACCACCTTTTTTTACTATGACCTTCAGAGCCAGCCGTGTGAGA
ACCAGGCCTGGGTCTTTGCTACCCTCGCCACCACTGTCCTATACTGCCTGGTGTTTCTCCTCAGCCTAGT
GGGCAACAGCCTGGTCCTGTGGGTCCTGGTGAAGTATGAGAGCCTGGAGTCCCTCACCAACATCTTCATC
CTCAACCTGTGCCTCTCAGACCTGGTGTTCGCCTGCTTGTTGCCTGTGTGGATCTCCCCATACCACTGGG
GCTGGGTGCTGGGAGACTTCCTCTGCAAACTCCTCAATATGATCTTCTCCATCAGCCTCTACAGCAGCAT
CTTCTTCCTGACCATCATGACCATCCACCGCTACCTGTCGGTAGTGAGCCCCCTCTCCACCCTGCGCGTC
CCCACCCTCCGCTGCCGGGTGCTGGTGACCATGGCTGTGTGGGTAGCCAGCATCCTGTCCTCCATCCTCG
ACACCATCTTCCACAAGGTGCTTTCTTCGGGCTGTGATTATTCCGAACTCACGTGGTACCTCACCTCCGT
CTACCAGCACAACCTCTTCTTCCTGCTGTCCCTGGGGATTATCCTGTTCTGCTACGTGGAGATCCTCAGG
ACCCTGTTCCGCTCACGCTCCAAGCGGCGCCACCGCACGGTCAAGCTCATCTTCGCCATCGTGGTGGCCT
ACTTCCTCAGCTGGGGTCCCTACAACTTCACCCTGTTTCTGCAGACGCTGTTTCGGACCCAGATCATCCG
GAGCTGCGAGGCCAAACAGCAGCTAGAATACGCCCTGCTCATCTGCCGCAACCTCGCCTTCTCCCACTGC
TGCTTTAACCCGGTGCTCTATGTCTTCGTGGGGGTCAAGTTCCGCACACACCTGAAACATGTTCTCCGGC
AGTTCTGGTTCTGCCGGCTGCAGGCACCCAGCCCAGCCTCGATCCCCCACTCCCCTGGTGCCTTCGCCTA
TGAGGGCGCCTCCTTCTACTGA


Restriction Sites SgfI-MluI     
ACCN NM_001024644
ORF Size 1002 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001024644.1, NP_001019815.1
RefSeq Size 1251
RefSeq ORF 1002
Locus ID 2829
Protein Families Druggable Genome, GPCR, Transmembrane
Protein Pathways Chemokine signaling pathway, Cytokine-cytokine receptor interaction
Gene Summary The protein encoded by this gene is a chemokine receptor belonging to the G protein-coupled receptor superfamily. The family members are characterized by the presence of 7 transmembrane domains and numerous conserved amino acids. This receptor is most closely related to RBS11 and the MIP1-alpha/RANTES receptor. It transduces a signal by increasing the intracellular calcium ions level. The viral macrophage inflammatory protein-II is an antagonist of this receptor and blocks signaling. Two alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) lacks an exon in the 5' UTR, as compared to variant 1. Variants 1 and 2 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.