CCXCR1 (XCR1) (NM_001024644) Human Untagged Clone
CAT#: SC302272
XCR1 (untagged)-Human chemokine (C motif) receptor 1 (XCR1), transcript variant 2
"NM_001024644" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | XCR1 |
Synonyms | CCXCR1; GPR5 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001024644, the custom clone sequence may differ by one or more nucleotides
ATGGAGTCCTCAGGCAACCCAGAGAGCACCACCTTTTTTTACTATGACCTTCAGAGCCAGCCGTGTGAGA ACCAGGCCTGGGTCTTTGCTACCCTCGCCACCACTGTCCTATACTGCCTGGTGTTTCTCCTCAGCCTAGT GGGCAACAGCCTGGTCCTGTGGGTCCTGGTGAAGTATGAGAGCCTGGAGTCCCTCACCAACATCTTCATC CTCAACCTGTGCCTCTCAGACCTGGTGTTCGCCTGCTTGTTGCCTGTGTGGATCTCCCCATACCACTGGG GCTGGGTGCTGGGAGACTTCCTCTGCAAACTCCTCAATATGATCTTCTCCATCAGCCTCTACAGCAGCAT CTTCTTCCTGACCATCATGACCATCCACCGCTACCTGTCGGTAGTGAGCCCCCTCTCCACCCTGCGCGTC CCCACCCTCCGCTGCCGGGTGCTGGTGACCATGGCTGTGTGGGTAGCCAGCATCCTGTCCTCCATCCTCG ACACCATCTTCCACAAGGTGCTTTCTTCGGGCTGTGATTATTCCGAACTCACGTGGTACCTCACCTCCGT CTACCAGCACAACCTCTTCTTCCTGCTGTCCCTGGGGATTATCCTGTTCTGCTACGTGGAGATCCTCAGG ACCCTGTTCCGCTCACGCTCCAAGCGGCGCCACCGCACGGTCAAGCTCATCTTCGCCATCGTGGTGGCCT ACTTCCTCAGCTGGGGTCCCTACAACTTCACCCTGTTTCTGCAGACGCTGTTTCGGACCCAGATCATCCG GAGCTGCGAGGCCAAACAGCAGCTAGAATACGCCCTGCTCATCTGCCGCAACCTCGCCTTCTCCCACTGC TGCTTTAACCCGGTGCTCTATGTCTTCGTGGGGGTCAAGTTCCGCACACACCTGAAACATGTTCTCCGGC AGTTCTGGTTCTGCCGGCTGCAGGCACCCAGCCCAGCCTCGATCCCCCACTCCCCTGGTGCCTTCGCCTA TGAGGGCGCCTCCTTCTACTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001024644 |
ORF Size | 1002 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001024644.1, NP_001019815.1 |
RefSeq Size | 1251 |
RefSeq ORF | 1002 |
Locus ID | 2829 |
Protein Families | Druggable Genome, GPCR, Transmembrane |
Protein Pathways | Chemokine signaling pathway, Cytokine-cytokine receptor interaction |
Gene Summary | The protein encoded by this gene is a chemokine receptor belonging to the G protein-coupled receptor superfamily. The family members are characterized by the presence of 7 transmembrane domains and numerous conserved amino acids. This receptor is most closely related to RBS11 and the MIP1-alpha/RANTES receptor. It transduces a signal by increasing the intracellular calcium ions level. The viral macrophage inflammatory protein-II is an antagonist of this receptor and blocks signaling. Two alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) lacks an exon in the 5' UTR, as compared to variant 1. Variants 1 and 2 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC221929 | XCR1 (Myc-DDK-tagged)-Human chemokine (C motif) receptor 1 (XCR1), transcript variant 2 |
USD 420.00 |
|
RG221929 | XCR1 (GFP-tagged) - Human chemokine (C motif) receptor 1 (XCR1), transcript variant 2 |
USD 460.00 |
|
RC221929L3 | Lenti ORF clone of Human chemokine (C motif) receptor 1 (XCR1), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC221929L4 | Lenti ORF clone of Human chemokine (C motif) receptor 1 (XCR1), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review